Click it edu flow cytometry assay kit

Manufactured by Thermo Fisher Scientific

Sourced in United States

The Click-iT EdU Flow Cytometry Assay Kit is a tool designed to detect and quantify cellular proliferation. It utilizes a thymidine analog, EdU (5-ethynyl-2'-deoxyuridine), which is incorporated into DNA during active DNA synthesis. The incorporated EdU is then detected using a copper-catalyzed click reaction, enabling the identification and measurement of proliferating cells through flow cytometry analysis.

Automatically generated - may contain errors

Lab products found in correlation

Facsaria, by BD (7 mentions) Facscanto 2, by BD (6 mentions) 5 ethynyl 2 deoxyuridine (edu), by Thermo Fisher Scientific (6 mentions) Facscalibur flow cytometer, by BD (5 mentions) Cm h2dcfda, by Thermo Fisher Scientific (4 mentions) Fxcycle far red stain, by Thermo Fisher Scientific (4 mentions) Rnase a, by Merck Group (4 mentions) Click it edu imaging kit, by Thermo Fisher Scientific (4 mentions) Facscalibur, by BD (4 mentions) Lsrii flow cytometer, by BD (4 mentions) Facsverse flow cytometer, by BD (3 mentions) Bovine serum albumin (bsa), by Merck Group (3 mentions) Lsrfortessa, by BD (3 mentions) 5 ethynyl 2 deoxyuridine edu, by Thermo Fisher Scientific (3 mentions) Propidium iodide, by Merck Group (3 mentions) Cytoflex flow cytometer, by Beckman Coulter (3 mentions) Facscanto 2 cytometer, by BD (3 mentions) Facscanto 2 flow cytometer, by BD (2 mentions) Facsaria 2, by BD (2 mentions) Fetal bovine serum (fbs), by Thermo Fisher Scientific (2 mentions)

Spelling variants of this product

Flow cytometry (135 citations) Click-iT EdU (80 citations) EdU assay kit (30 citations) EdU assay (10 citations) EdU Flow Cytometry Assay Kits (4 citations) Click-iTTM EdU Flow Cytometry Assay Kit (4 citations) Click-iTTM Plus EdU flow Cytometry Assay Kit (3 citations) Click-iTTM EdU Alexa FluorTM 647 Flow Cytometry Assay Kit (3 citations) Click-iTTM Plus EdU Alexa FluorTM 647 flow cytometry assay kit (2 citations) Click-iTTM EdU Pacific BlueTM Flow Cytometry Assay Kit (2 citations)

167 protocols using click it edu flow cytometry assay kit

Cell Cycle Progression Evaluation

Check if the same lab product or an alternative is used in the 5 most similar protocols

The level of incorporation of EdU and BrdU determined the progress of S phase, Click-iT EdU Flow Cytometry Assay kits (Thermo Fisher Scientific Inc) and FITC-conjugated anti-BrdU (BD Biosciences) were used. Before being harvested, cells were treated with 10 mmol/L of EdU for 1 h, 20 mmol/L BrdU for 15 min, fixed in 70% ethanol, and stored at −20 °C. DNA denaturation was performed in 4 M HCl for 20 min at room temperature, after which cells were resuspended in phosphate/citric acid Alternatively, BrdU and EdU incorporation levels were determined using S phase, using kit and antibody buffer. Cells were then treated with 7-AAD (BD Biosciences) and fluorescence was measured using a FACS Canto II flow cytometer (BD Biosciences). Finally, pacific blue-conjugated phospho-histone H3 (Ser10) and Click-iT EdU Flow Cytometry Assay kits (Thermo Fisher Scientific Inc) were used to identify mitotic entry status.

Ha D.H., Min A., Kim S., Jang H., Kim S.H., Kim H.J., Ryu H.S., Ku J.L., Lee K.H, & Im S.A. (2020). Antitumor effect of a WEE1 inhibitor and potentiation of olaparib sensitivity by DNA damage response modulation in triple-negative breast cancer. Scientific Reports, 10, 9930.

+ Open protocol

+ Expand

Cell Cycle Analysis via EdU and PI

Check if the same lab product or an alternative is used in the 5 most similar protocols

Asynchronously growing or G1/S-arrested cells were prepared and fixed as in Black et al. (2010) (link). Cells were stained with 10 µM EdU for 1 h prior to collection. Cell cycle was analyzed by PI staining or EdU incorporation using a Click-IT EdU flow cytometry assay kit (Life Technologies). Flow cytometry of CD4⁺ T cells and cell cycle distribution were analyzed using a BD FACS ARIA II.

Black J.C., Atabakhsh E., Kim J., Biette K.M., Van Rechem C., Ladd B., Burrowes P.D., Donado C., Mattoo H., Kleinstiver B.P., Song B., Andriani G., Joung J.K., Iliopoulos O., Montagna C., Pillai S., Getz G, & Whetstine J.R. (2015). Hypoxia drives transient site-specific copy gain and drug-resistant gene expression. Genes & Development, 29(10), 1018-1031.

+ Open protocol

+ Expand

Measuring SIV-specific T Cell Proliferation

Check if the same lab product or an alternative is used in the 5 most similar protocols

PBMC were enriched by Ficoll gradient centrifugation of blood obtained from rhesus macaques chronically infected with SIVmac239 and undergoing cART. These animals that controlled plasma viral loads below 1000 copies/ml and exhibited normal monocyte turnover and phenotype (data not shown) were selected for this study since they expressed SIV-specific cell proliferation and immune responses. Monocytes, DC subsets, and CD3⁺ T cells were sorted by flow cytometry using the BD FACS Aria (Figure 1). Each monocyte and DC population was incubated for 2 hr with SIVmac251 Gag PR55 protein (NIH AIDS Research & Reference Reagent Program) for stimulating antigen-specific CD3⁺ T cell proliferation ex vivo. After washing with RPMI 1640 supplemented with 10% FBS, 10000, 5000, and 2500 cells of Gag-pulsed monocytes or DC subsets were cultured with 1 × 10⁵ CD3⁺ T cells in a 96-well U-bottom culture plate for 4.5 days. Another thymidine analogue, 5-ethynyl-2´-deoxyuridine (EdU) was added at a final concentration of 10 µM during the last 18 hr of the culture and cell proliferation was detected as a function of EdU incorporation using the Click-iT EdU Flow Cytometry Assay Kit (Life Technologies). Results were acquired using a FACS Verse flow cytometer (BD Biosciences) and data were analyzed by FlowJo software.

Sugimoto C., Hasegawa A., Saito Y., Fukuyo Y., Chiu K.B., Cai Y., Breed M.W., Mori K., Roy C.J., Lackner A.A., Kim W.K., Didier E.S, & Kuroda M.J. (2015). Differentiation kinetics of blood monocytes and dendritic cells in macaques: insights to understanding human myeloid cell development. Journal of immunology (Baltimore, Md. : 1950), 195(4), 1774-1781.

+ Open protocol

+ Expand

Multiparameter Immune Cell Profiling

Check if the same lab product or an alternative is used in the 5 most similar protocols

Cells were stained using fluorescently conjugated monoclonal antibodies to CD3-PerCP (clone SP34–2), CD4-FITC (clone RPA-T4), in combination with either CCR5-PE (clone 3A9), CXCR4-PE (clone 12G5), or the activation marker CD69-PE (clone FN50), all from BD Biosciences (Franklin Lakes, New Jersey, USA). Corresponding fluorescent isotype controls were used at the same concentrations as the reference antibody. Cells were stained with antibodies by incubation for 30 min at 4°C, washed in PBS-1% FCS and fixed in 1.5% paraformaldehyde. Proliferation assays were performed using the Click-iT EdU Flow Cytometry Assay kit (Life Technologies), as per manufacturer instructions. A gate (PBMC gate) was defined in the analysis to exclude nonviable cells and debris. The percentage of live/dead cells in the PBMC gate and in the CD4⁺ cell population was analyzed using the Live/dead Fixable dead cell stain kit, as described above. Acquisition was performed with a FACScalibur flow cytometer (Becton Dickinson) and CELLQuestPro Software was used for analysis. The cell surface expression levels in the flow cytometry profiles are expressed as mean fluorescence intensity (MFI) indices. The percentage of stained cells is also presented.

Camus C., Matusali G., Bourry O., Mahe D., Aubry F., Bujan L., Pasquier C., Massip P., Ravel C., Zirafi O., Munch J., Roan N.R., Pineau C, & Dejucq-Rainsford N. (2016). Comparison of the effect of semen from HIV-infected and uninfected men on CD4+ T-cell infection. AIDS (London, England), 30(8), 1197-1208.

+ Open protocol

+ Expand

Murine T-Cell Activation and Expansion

Check if the same lab product or an alternative is used in the 5 most similar protocols

Golgi Plug Protein Transport Inhibitor, Cytofix/Cytoperm Solution, PermWash buffer and 70 µm cell strainer were purchased from BD Pharmingen (Franklin Lakes, USA). Click.iT EdU flow cytometry assay kit and sytox AADvanced from Life Technologies Corporation (Carlsbad, USA). Murine MicroBeads CD4 (L3T4), CD8α (Ly2) and the CD4/CD8 T-cell activation/Expansion Kit mouse were purchased from Miltenyi Biotec GmbH (Bergisch Gladbach, Germany). LPS (L2880) were purchased from Sigma-Aldrich (St.Louis, USA). Vetbond tissue adhesive from 3 M (St. Paul, USA). EDTA-capillary and Li-Heparin-capillary tubes were acquired from Sarstedt (Nümbrecht, Germany). RPMI 1640 medium from Biochrome AG (Berlin, Germany). FCS from Biowest LLC (Kansas City, USA). 2-Mercapto-ethanol from Roth (Karlsruhe, Germany). VitaLyse Lysing Buffer from BioE (St. Paul, USA). Streptavidin from Dianova (Hamburg, Germany). 24-well plates from Corning Incorporated (Corning, USA). CFSE from Enzo Lifescience Inc. (Lörrach, Germany). Lauryl-maltoside (n-Dodecyl-ß-D-maltoside, ULTROL Grade) from Calbiochem (Bad Soden, Germany). CpG (TCCATGACGTTCCTGACGTT) was acquired from Sigma-Aldrich (St.Louis, USA). GP33–41 (KAVYNFATM) and GP61–80 (GLKGPDIYKGVYQFKSVEFD) peptides were synthesized by Bio-Synthesis (Louisville, USA).

Markwart R., Condotta S.A., Requardt R.P., Borken F., Schubert K., Weigel C., Bauer M., Griffith T.S., Förster M., Brunkhorst F.M., Badovinac V.P, & Rubio I. (2014). Immunosuppression after Sepsis: Systemic Inflammation and Sepsis Induce a Loss of Naïve T-Cells but No Enduring Cell-Autonomous Defects in T-Cell Function. PLoS ONE, 9(12), e115094.

+ Open protocol

+ Expand

Cell Proliferation Assay with EdU

Check if the same lab product or an alternative is used in the 5 most similar protocols

MDA-MB-231 cells were incubated with 10 μM EdU for 4 h, 96 h after siRNA transfection. Cell fixation, permeabilization and EdU detection was performed using the Click-iT EdU Flow Cytometry Assay Kit (Life Technologies) following the manufacturer’s instructions. Data were collected and analysed using a BD LSR II flow cytometer using 488 nm excitation and a 520/20 band-pass for detection of EdU Alexa Fluor488 azide and 355 nm excitation and a 450/50 band-pass for detection of 4',6-diamidino-2-phenylindole. Experiments were performed with biological triplicate samples and 30,000 cells were analysed per sample. A no-EdU control sample was used to inform our gating strategy to calculate the proportion of EdU-positive cells.

Best A., James K., Dalgliesh C., Hong E., Kheirolahi-Kouhestani M., Curk T., Xu Y., Danilenko M., Hussain R., Keavney B., Wipat A., Klinck R., Cowell I.G., Cheong Lee K., Austin C.A., Venables J.P., Chabot B., Santibanez Koref M., Tyson-Capper A, & Elliott D.J. (2014). Human Tra2 proteins jointly control a CHEK1 splicing switch among alternative and constitutive target exons. Nature Communications, 5, 4760.

+ Open protocol

+ Expand

Synthesis and Characterization of Polymeric Nanocarriers

Check if the same lab product or an alternative is used in the 5 most similar protocols

DTX was purchased from Knowshine (Shanghai, China). Methoxy poly(ethyleneglycol)-poly(ε-caprolactone) (MPEG-PCL)(Mw: 3 k–15 k) and FITC-conjugated poly(ethyleneglycol)-poly(ε-caprolactone) (FITC-PEG-PCL)(Mw: 3 k–15 k) were synthesized as previously described27 (link). The near infrared dye 1,1′-Dioctadecyl-3,3,3′,3′-tetramethylindotricarbocyanine Iodide (DiR) was purchased from Biotium (Hayward, CA). DAPI was purchased from Beyotime (Haimen, China).U87 and A549 cells were purchased from the Institute of Biochemistry and Cell Biology, Shanghai Institute for Biological Sciences, Chinese Academy of Sciences (Shanghai, China). Plastic cell culture dishes and plates were purchased from Wuxi NEST Biotechnology Co. Ltd. (Wuxi, China). LysoTracker Red, MitoTracker Red, Click iT™ EdU flow cytometry assay kit, Dulbecco's Modified Eagle Medium (high glucose) cell culture medium (DMEM) and FBS were purchased from Life Technologies (Grand Island, NY, USA). All other chemicals were analytical reagent grades and were purchased from Sinopharm Chemical Reagent (Shanghai, China).
BALB/c nude mice (male, 4–5 weeks, 18–22 g) were obtained from the Shanghai Slac Laboratory Animal Co, Ltd. (Shanghai, China) and maintained under standard housing conditions. All animal experiments were carried out in accordance with protocols evaluated and approved by the ethics committee of SIchuan University.

Gao H., Hu G., Zhang Q., Zhang S., Jiang X, & He Q. (2014). Pretreatment with chemotherapeutics for enhanced nanoparticles accumulation in tumor: the potential role of G2 cycle retention effect. Scientific Reports, 4, 4492.

+ Open protocol

+ Expand

Proliferative Capacity Assessment via EdU Uptake

Check if the same lab product or an alternative is used in the 5 most similar protocols

To determine the proliferative capacity of cultured cells, 5-ethynyl-2′-deoxyuridine (EdU) uptake analysis was performed using Click-iT® EdU flow cytometry assay kit (Life Technologies). For the assay, cells were prepared as recommended by the manufacturer's instruction. Briefly, cells were cultured for 48 h and subsequently treated with 10 μM EdU for 2 h, harvested, and washed in phosphate-buffered saline (PBS; Gibco) containing 1% bovine serum albumin (BSA; Sigma-Aldrich). After fixation and permeabilization, EdU-incorporation was visualized in Click-iT reaction cocktail containing Alexa Flour® 488 azide. After being rinsed, 1 × 10⁴ cells per condition were analyzed by the BD FACSCalibur flow cytometer (BD Biosciences).

Woo Y., Lee H., Jeong Y.S., Shin G.Y., Oh J.G., Kim J.S, & Oh J. (2017). Antioxidant Potential of Selected Korean Edible Plant Extracts. BioMed Research International, 2017, 7695605.

+ Open protocol

+ Expand

Evaluating Cell Viability and Proliferation

Check if the same lab product or an alternative is used in the 5 most similar protocols

Cell viability was evaluated by MTS assay (Promega). Cells were incubated with MTS reagents for 1 h 45 every 24-hours over a period of 6 days. Quantification was performed by measuring the absorbance at 490 nm. Cell proliferation was evaluated by 5-ethynyl-2′-deoxyuridine EdU incorporation assay (Click-iT EdU Flow Cytometry Assay Kit, Life Technologies). EdU reagent was used at a final concentration of 10 μM 6 h before harvesting the cells which were treated according to the manufacturer’s protocol. Cells were analyzed 3 days after transfection. EdU incorporation was analyzed by flow cytometry on the BD LSRFortessa cell analyzer.

Augenlicht A., Saiselet M., Decaussin-Petrucci M., Andry G., Dumont J.E, & Maenhaut C. (2021). MiR-7-5p inhibits thyroid cell proliferation by targeting the EGFR/MAPK and IRS2/PI3K signaling pathways. Oncotarget, 12(16), 1587-1599.

+ Open protocol

+ Expand

Multiparametric Flow Cytometry Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Cells were washed in PBS and subjected to Fc receptor blocking (TruStain, Biolegend) for 10 min at room temperature. 10⁶ cells per ml were used to perform staining with antibodies listed for 15-30 min at 4°C. After washing with PBS, cells were suspended in PBS with propidium iodide (PI, 0.2 μg/mL) or DAPI (0.75 μg/mL) to exclude dead cells. For cell-cycle analysis, the Click-iT EdU Flow Cytometry Assay Kit (Life Technologies) was used according to the manufacturer’s instructions. To measure intracellular ROS levels, cells were incubated for 7 min with 1 μmol/L 5-(and-6)-chloromethyl-2’,7’-dichlorodihydrofluorescein diacetate, acetyl ester (CM-H₂DCFDA, Life Technologies) at 37°C. After washing with PBS, the cells were incubated for additional 15 min at 37°C in PBS. Fluorescence signals from oxidated CM-H₂DCFDA in viable cells were measured by flow cytometry. All flow cytometry assays were performed on a LSRFortessa (BD Biosciences). All the fluorescence-activated cell sorting procedures were performed on a FACSAria II (BD Biosciences). Flow cytometry data were exported and analyzed with FlowJo (FlowJo, LLC).

Xiao G., Chan L.N., Klemm L., Braas D., Chen Z., Geng H., Zhang Q.C., Aghajanirefah A., Cosgun K.N., Sadras T., Lee J., Mirzapoiazova T., Salgia R., Ernst T., Hochhaus A., Jumaa H., Jiang X., Weinstock D.M., Graeber T.G, & Müschen M. (2018). B cell-specific diversion of glucose carbon utilization reveals a unique vulnerability in B cell malignancies. Cell, 173(2), 470-484.e18.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!