Scrambled sirna sc 37007

siRNA transfections were performed using Lipofectamine RNA iMAX (Thermo Fisher Scientific) according to the manufacturer's protocol. Two sequences of siRNAs have been used in the current study; one is Mission Si RNA USP37 (Sigma Aldrich) with the target sequence; TGAGGTTCAGCACTCCATCATTTGTAAAGCATGTGGAGAGATTATCCCCAAAAGAGAACAGTTTAATGACCTCTCTATTGACCTTCCTCGTAGGAAAAAACCACTCCCTCCTCGTTCAATTCAAGATTCTCTTGATCTTTTCTTTAGGGCCGAAGAACTGGAGTATTCTTGTGAGAAGTGTGGTGGGAAGTGTGCTCTTGTCAGGCACAAATTTAACAGGCTTCCTAGGGTCCTCATTCTCCATTTGAAACGATATAGCTTCAATGTGGCTCTCTCGCTTAACAATAAGATTGGGCAGCAAGTCATCATTCCAAGATACCTGACCCTGTCATCTCATTGCACTGAAAATACAAAACCACCTTTTACCCTTGGTTGGAGTGCACATATGGCAATTTCTAGACCATTGAAAGCCTCTCAAATGGTGAATTCCTGCA and other is USP37 siRNA (sc-76845) (Santacruz Biotechnology). Scrambled siRNA (SC 37007, Santacruz Biotechnology) was used a control. Myc-USP37 and USP37 C50A plasmids were gift from Summers Lab, Ohio State University, Columbus, Ohio, USA, and have been described previously [23 (link)]; HA-Ubiquitin (Plasmid #18712) plasmid was purchased from addgene repository where it was deposited by Edward Yeh lab. Plasmid transfections were performed using Lipofectamine 3000 and RNA iMAX (Thermofisher) according to the manufacturer's protocol.

MeCP2 siRNA transfection was performed as previously publication54 (link). Briefly, HUVECs was transfected with 10 nM MeCP2 siRNA(2 hrs) (sc-156056) or scrambled siRNA (sc-37007) (Santa Cruz Biotechnology, Dallas, TX, USA) using HiPerFect Transfection Reagent (QIAGEN) as instructed by the manufacture. 48 hrs after the transfection, the cells were harvested and protein was extracted from the cells for MeCP2 and VEGF expression by western blot analysis.

For overexpression experiments, the PINK1 cDNA was amplified using the primer pair 5′-CGCAAATGGGCGGTAGGCGTG-3′ (forward) and 5′-TAGAAGGCACAGTCGAGG-3′ (reverse). Before transfection, SCCs were seeded in 12-well culture dishes and grown to 80–90% confluence, and then serum-starved for 2 h. The overexpression plasmid [pcDNA3.1(+)-PINK1-V5] or the empty vector [pcDNA3.1(+)-MCS-V5] (both from OBiO, Shanghai, China) was then transfected into the SCCs using Lipo2000 (Invitrogen). For siRNA experiments, SCCs were transfected with 50 nM PINK1 siRNA (sc-44598) or scrambled siRNA (sc-37007) (both from Santa Cruz Biotechnology, Santa Cruz, CA, United States).
After transfection, the SCCs were collected at 48 h for RNA detection and 72 h for protein detection. For osteogenic induction, the transfection medium was replaced with an osteogenic induction medium the following day.

Gene silencing was achieved though transfection with siRNA using the Lipofectamine 2000 transfection reagent following the manufacturer’s instructions. OGT siRNA (sc-40780), GFAT siRNA (sc-6068), XBP1 siRNA (sc-38627), GRP78 siRNA (sc-29338) and scrambled siRNA (sc-37007) were obtained from Santa Cruz Biotechnology (CA, USA).
Transfection of the MCF-7 cell line was performed with Lipofectamine according to the manufacturer’s instructions. Under our conditions, 30–40% of cells are routinely transfected. The stably transfected cells were then selected by the addition of 800 μg/mL geneticin (G418), which was purchased from Invitrogen, to the medium. After 3 weeks, the selected stably transfected cells were further cultured with G418 at a concentration of 400 μg/mL and OGT-overexpressing clones were selected for other experiments.

PrP^C-specific antibodies 3F4 and 8H4 were obtained from Signet laboratories (Dedham, MA, USA). 3F4 binds to an epitope on amino acids 109–112 (Human PrP sequence), while 8H4 binds an epitope in the C-terminal amino acids 145–180 of human and mouse PrP^{62 (link)}. Other primary antibodies were obtained from the following sources: anti-ferritin (F5012, Sigma Aldrich, USA), anti-DMT-1 (ab55812, Abcam, USA), anti-TfR (ab84036, Abcam, USA), anti-Tf (GTX21223, GeneTex, USA), and anti-β-actin (MAB1501, Millipore, USA) Secondary antibodies conjugated with HRP were from GE Healthcare (anti-mouse, LNA931V, anti-rabbit, LNA934V). Alexa fluor-conjugated secondary antibodies were from molecular probes, ImmPACT DAB (SK4105) from Vector labs, USA, PNGase F (P0704S) from NEB, USA and Lipofectamine 3000 transfection reagent from Invitrogen, USA. Radiolabeled ⁵⁹FeCl₃ was obtained from Perkin-Elmer, USA. siRNA against PrP (sc36318) and scrambled siRNA (sc37007) were purchased from Santa Cruz Biotechnology Inc, USA. For immunohistochemistry of hamster retinal sections PrP-6C2 (CVI-WUR, Lelystad, Netherland), ferritin (Jackson ImmunoResearch, West Grove, PA, USA), and Iba1 (019–19741, Wako Chemicals, USA) antibodies were used. FAC (F5879) and all other chemicals were from Sigma Aldrich, USA.