Ta vector

For deletion of the pri-miR-211 region which encodes for the mature hsa-miR-211, two guide RNAs encompassing the pri-miR-211 region were designed as follows: 5’gRNA-TTCCCAATGACCATTCGCC and 3’gRNA- TATCAATCCTTGCTTGGGTTG and cloned into a vector containing the Cas9 protein (Lee et al., 2017 ) using the AatII or BstZI restriction enzymes for the 5’ and 3’ gRNAs respectively. The cloned vector was transformed into bacteria and bacterial colonies were picked and the plasmid DNA was extracted and sequenced. Upon identification of the correct clone, the DNA was transfected into either SKMEL-28 or 501-Mel melanoma cell lines using FUGENE (Promega, Madison, WI) and 48hrs later selected with appropriate antibiotic (blasticidin) for 1-2 weeks, followed by limiting dilution cloning in 96-well dish to produce individual clones. After clones were large enough, genomic DNA was extracted and the sequence deletion in the genomic DNA was confirmed by genomic PCR as well as by PCR amplifying the edited genomic DNA, cloning into TA vector (TaKaRa, Mountain View, USA), and sequencing. The stable clones with the deleted pri-miR-211 sequence were then further amplified for further in vitro and in vivo characterization.