Control sirna

Manufactured by Bioneer

Sourced in United States, Cameroon

Control siRNA is a laboratory tool used to establish baseline gene expression levels in RNA interference (RNAi) experiments. It serves as a negative control, allowing researchers to differentiate the effects of their target siRNA from non-specific changes in gene expression.

Automatically generated - may contain errors

Lab products found in correlation

65 protocols using control sirna

Overexpression and Knockdown of Hdac8 and Ace1 in H9c2 Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

To overexpress Hdac8, H9c2 cells were transfected with 1.6 μg of pCMV-HA-myc or pCMV-Hdac8-HA-myc plasmids for 2 days using Lipofectamine and PLUS reagents, following the manufacturer's instructions. Additionally, the H9c2 cells were transfected with 1.6 μg of pCMV6-SPORT6 or pCMV6-SPORT6-Ace1 plasmids for 2 days to overexpress Ace1. The pCMV6-SPORT6-Ace1 clone was obtained from the Korea Human Gene Bank, Medical Genomics Research Center, KRIBB, Korea.
To knockdown Hdac8 or Ace1, H9c2 cells were transfected with 100 nM control siRNAs (cat no. SN-1003, Bioneer, Daejeon, South Korea), si-Hdac8 (cat no. L-096589-02-0005, Dharmacon, Lafayette, CO, USA), or si-Ace1 (product name 24310, Bioneer) using RNAiMAX reagent.
The siRNA sequences were as follows: control sense, 5′-CCU ACG CCA AUU UCG U-3′ and control antisense, 5′-ACG AAA UUG GUG GCG UAG G-3′; si-Ace1 #1, 5′-CUC AGU AAU GAA GCC UAC A-3′; si-Ace1 #2, 5′-CAU UUG ACG UGA GCA ACU U-3′; si-Ace1 #3, 5′-ACA AAC CCA ACC UCG AUG U-3′; si-Hdac8 #1: 5′-UAG AAU AUG GAC UAG GUU A-3′; si-Hdac8 #2, 5′-GAU CCA AUG UGC UCC UUU A-3′; si-Hdac8 #3, 5′-CAG CAU AUG GUC CUG AUU A-3′; and si-Hdac8 #4: 5′-CAG AAG GGA UAU UUG ACU A-3′.

Zhao T., Kee H.J., Kee S.J, & Jeong M.H. (2022). Hdac8 Inhibitor Alleviates Transverse Aortic Constriction-Induced Heart Failure in Mice by Downregulating Ace1. Oxidative Medicine and Cellular Longevity, 2022, 6227330.

+ Open protocol

+ Expand

Silencing SREBF1 Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Human SREBF1 siRNAs (6720, Bioneer, Daedeok-gu, Daejeon, Korea) and control siRNAs (Bioneer) were transiently transfected into cells with Lipofectamin 2000 transfection reagent according to the manufacturer’s instructions (Thermo Fisher Scientific, Carlsbad, CA, USA). After 24 h, the cells were harvested for immunoblotting.

Kim Y., Jee W., An E.J., Ko H.M., Jung J.H., Na Y.C, & Jang H.J. (2022). Timosaponin A3 Inhibits Palmitate and Stearate through Suppression of SREBP-1 in Pancreatic Cancer. Pharmaceutics, 14(5), 945.

+ Open protocol

+ Expand

Knockdown of COX-2, COX-1, and RhoA in Macrophages

Check if the same lab product or an alternative is used in the 5 most similar protocols

RAW 264.7 cells and resident peritoneal macrophages were transiently transfected with 1 μg/mL of either siRNA specifically targeting COX-2 or COX-1 or control siRNA (Bioneer, Seoul, Korea) using 5 μL of siRNA transfection reagent (Genlantis, San Diego, CA) according to the manufacturer's protocol. The sequences used for COX-2 knockdown were 5′-CUA UGA UAG GAG CAU GUA A-3′ (sense) and 5′-UUA CAU GCU CCU AUC AUA G-3′ (antisense). The sequences used for COX-1 knockdown were 5′-GAG GUA GGA ACU UUG ACU A-3′ (sense) and 5′-UAG UCA AAG UUC CUA CCU C-3′ (antisense). The sequences for control siRNA were 5′-CCU ACG CCA CCA AUU UCG U-3′ (sense) and 5′-ACG AAA UUG GUG GCG UAG G-3′ (antisense). Before further experiments, cells were incubated in serum-free medium for 6 h for COX-2 siRNA or 48 h for COX-1 siRNA. For RhoA siRNA, RAW 264.7 cells were transiently transfected with 10 nM RhoA-targeting siRNA (sense: 5′-GAA GUC AAG CAU UUC UGU CTT-3′; antisense: 5′-GAC AGA AAU GCU UGA CUU CTT-3′) premixed with 6 μg/mL of Lipofectin (Invitrogen). Cells were then incubated in serum-free medium for 24 h before further experimentation. None of the siRNAs used had any significant effect on cell viability.

Byun J.Y., Youn Y.S., Lee Y.J., Choi Y.H., Woo S.Y, & Kang J.L. (2014). Interaction of Apoptotic Cells with Macrophages Upregulates COX-2/PGE2 and HGF Expression via a Positive Feedback Loop. Mediators of Inflammation, 2014, 463524.

+ Open protocol

+ Expand

Molecular Tools for ER-Mitochondria Interactions

Cited 2 times

Check if the same lab product or an alternative is used in the 5 most similar protocols

siRNAs targeting PDK4 (#1406883), GRP75 (#1370988), IP3R1 (#1374717), PDHE1α (#1406708), and Foxo1 (#1359213) and control siRNA (#SN-1003) were purchased from Bioneer (Daejeon, South Korea). PDK4 kinase dead (ΔPDK4-flag) plasmid construct was designed by deleting the nucleic acid sequence that encodes the aspartate and tryptophan DW (Asp³⁹⁴-Trp³⁹⁵) motif as previously reported (19 (link)). D1ER and 4mitD3 plasmids were provided by K.-S.P. (Yonsei University, Gangwon-Do, South Korea). Mitochondria-targeted blue fluorescence protein (mito-BFP), mitochondria-targeted GFP (mito-GFP), ER-targeted Sec61B-GFP, and a similar synthetic ER–mitochondria linker (Linker-RH) plasmid used in previous reports (4 (link),20 (link)) were provided by H.-W.R. (Seoul National University, Seoul, South Korea). Linker-RH carries mitochondria outer membrane–targeted A kinase anchor protein 1 (AKAP1), Linker (20 (link)), red fluorescent protein (RFP) mCherry, ER integral membrane protein phosphatidylinositide phosphatase Sac1, and hemagglutinin (HA) encoding sequences to obtain a 15- to 20-nm space between the ER and mitochondria outer membrane. The vector backbone of all of the constructs is pcDNA3. PDK4 adenovirus was provided by Dr. Y.-B. Kim (Harvard Medical School). pcDNA and mock adenovirus served as control for transient transfection and adenovirus transduction, respectively.

Thoudam T., Ha C.M., Leem J., Chanda D., Park J.S., Kim H.J., Jeon J.H., Choi Y.K., Liangpunsakul S., Huh Y.H., Kwon T.H., Park K.G., Harris R.A., Park K.S., Rhee H.W, & Lee I.K. (2018). PDK4 Augments ER–Mitochondria Contact to Dampen Skeletal Muscle Insulin Signaling During Obesity. Diabetes, 68(3), 571-586.

+ Open protocol

+ Expand

Autophagic Pathway Protein Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Primary antibodies specific for LC3B were purchased from Cell Signaling Technology (Cell Signaling Technology, Beverly, MA, USA), and those specific for NRBF2, Ki67, GAPDH, and β-actin were purchased from Santa Cruz Biotechnology (Santa Cruz Biotechnology, Santa Cruz, CA, USA). Antibodies specific for VPS34 were purchased from Echelon Biosciences (Echelon Biosciences, Salt Lake City, UT, USA), and antibodies specific for ATG14L were purchased from MBL (MBL, Tokyo, Japan). Secondary antibodies specific for mouse IgG and rabbit IgG were purchased from Enzo Life Sciences (Enzo Life Sciences, Ann Arbor, MI, USA). Dulbecco’s modified Eagle’s medium (DMEM), RPMI-1640, Hanks’ balanced salt solution (HBSS), phosphate buffered saline (PBS), and fetal bovine serum (FBS) were acquired from WelGENE Inc. (WelGENE Inc., Daegu, Korea). Penicillin‒streptomycin was obtained from Thermo Fisher Scientific (Thermo Fisher Scientific, Cleveland, OH, USA). siRNA specific for human NRBF2 and control siRNA were purchased from Bioneer (Bioneer, Daejeon, Korea).

Kim J., Kang H., Son B., Kim M.J., Kang J., Park K.H., Jeon J., Jo S., Kim H.Y., Youn H, & Youn B. (2022). NRBF2-mediated autophagy contributes to metabolite replenishment and radioresistance in glioblastoma. Experimental & Molecular Medicine, 54(11), 1872-1885.

+ Open protocol

+ Expand

Calpain-6 Silencing in Cultured Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

Control siRNA and mouse calpain-6 siRNA were purchased from Bioneer (Daejeon, Republic of Korea). Sequences of calpain-6 siRNAs were as following: siRNA #1 sense, 5′-GUGCUUGUUCCAACCAUGU-3′, siRNA #1 antisense, 5′-AC AUGGUUGGAACAAGCAC-3′, siRNA #2 sense, 5′-CUCUAG CGAUGAUCUCACU-3′, and siRNA #2 antisense, 5′-AGUGA GAUCAUCGCUAGAG-3′. When cell density reached approximately 50%, 30 nM duplex siRNA was transfected into cells using Lipofectamine^™ RNAiMAX (Thermo Fisher scientific, MA, USA) as described in the manufacturer’s instructions.

Kim B.H., Kim D.Y., Oh S., Ko J.Y., Rah G., Yoo K.H, & Park J.H. (2019). Deficiency of calpain-6 inhibits primary ciliogenesis. BMB Reports, 52(10), 619-624.

+ Open protocol

+ Expand

PTPN6 Knockdown by siRNA Transfection

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

To knockdown the PTPN6 expression, transfection of siRNA was performed as described previously.^{64 (link)} In brief, cells in 6-well plates were transfected with 100 nM/well of siRNA by Lipofectamine 2000 reagent (Invitrogen) in serum free media. Four hours after transfection, an equal volume of normal growth media containing 20% FBS was added to each well and the cells were further incubated for 3 days. Transfected cells were further treated with either DMSO or 12 for 24 h before harvest, and then Western blot analysis was performed. Densitometry analysis was performed by ImageJ.^{65 (link)} The siRNAs were purchased from Bioneer (Seoul, Korea) with following sequences: control-siRNA, 5′-GAC GAG CGG CAC GUG CAC AUU-3′; PTPN6-2, 5′-CAG UUC AUU GAA ACC ACU A(dTdT)-3′; and PTPN6-4, 5′-GAG AAC GCU AAG ACC UAC A(dTdT)-3′.

Hou S., Yi Y.W., Jin Kang H., Zhang L., Kim H.J., Kong Y., Liu Y., Wang K., Kong H.S., Grindrod S., Bae I, & Brown M.L. (2014). Novel Carbazole Inhibits Phospho-STAT3 through Induction of Protein–Tyrosine Phosphatase PTPN6. Journal of medicinal chemistry, 57(15), 6342-6353.

+ Open protocol

+ Expand

Modulating HDAC6, CSE and SIRT3 in Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

HDAC6, CSE and/or ubiquitin expression plasmids or corresponding empty vectors were transfected into HEK293 cells or HAECs using Lipofectamine 2000 for 1 day. For gene knockdown, double‐stranded small interfering RNA (siRNA) targeting CSE (5′‐GGUUAUUUAUCCUGGGCUGUU‐3′) or SIRT3 (5′‐CUGUGCCUAGUUGAACGGCAA‐3′), or control siRNA (5′‐UUCUCCGAACGUGUCACGUUU‐3′) from Bioneer were mixed with Lipofectamine RNAiMAX in Opti‐MEM I and the mixtures were added to cells for 2 days.

Chi Z., Le T.P., Lee S.K., Guo E., Kim D., Lee S., Seo S., Lee S.Y., Kim J.H, & Lee S.Y. (2020). Honokiol ameliorates angiotensin II‐induced hypertension and endothelial dysfunction by inhibiting HDAC6‐mediated cystathionine γ‐lyase degradation. Journal of Cellular and Molecular Medicine, 24(18), 10663-10676.

+ Open protocol

+ Expand

CD44v6 Knockdown and Functional Analysis

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

CD44v6 gene expression was knocked down using CD44v6 small interfering RNAs (siRNAs) as previously described 27 (link). Two CD44v6-specific siRNAs (v6-1: 5ʹ-AGU ACA ACG GAA ATT-3ʹ and v6-2: 5ʹ-GGA UAU CGC CAAACA CCC ATT-3ʹ) were synthesized by Bioneer (Daejeon, Korea). Control siRNA (5ʹ-CUA CGC CAA UUU CGU (dTdT)-3ʹ) were purchased from Bioneer. MDA-MB231 cells were transfected twice with a mixture of the CD44v6 siRNAs in Lipofectamine 2000 at an interval of 24 h. At 24-72 h post-transfection, the cells were lysed and subjected to Western blotting analysis using antibodies against CD44v6 and CD44. After 24 h of CD44v6 knockdown, cells were subjected to the peptide binding assays using a flow cytometer (BD) and confocal microscope (Zeiss) as described above.

Khan F., Gurung S., Gunassekaran G.R., Vadevoo S.M., Chi L., Permpoon U., Haque M.E., Lee Y.K., Lee S.W., Kim S, & Lee B. (2021). Identification of novel CD44v6-binding peptides that block CD44v6 and deliver a pro-apoptotic peptide to tumors to inhibit tumor growth and metastasis in mice. Theranostics, 11(3), 1326-1344.

+ Open protocol

+ Expand

Silencing RSF1 and SNF2H in Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

Two shRNAs for RSF1 were purchased from Sigma-Aldrich Co. hSNF2H-specific siRNAs and control siRNA were obtained from Bioneer Technology. The cells were transfected with shRNA or siRNA using lipofectamine (Invitrogen) according to the manufacturer's suggested protocol. Briefly, cells were plated in 6-well culture dishes and allowed to attach and grow for 24 hours before transfection. Each transfection mixture was prepared by mixing the shRNA or siRNA with lipofectamine in serum-free Opti-Modified Eagle Medium (Invitrogen). The mixtures were incubated for 15 minutes at room temperature. The transfection mixture was slowly added to the cells, which were allowed to recover for an additional 24 hours before experimental treatments.

Yang Y.I., Ahn J.H., Lee K.T., Shin I.M, & Choi J.H. (2014). RSF1 Is a Positive Regulator of NF-κB–Induced Gene Expression Required for Ovarian Cancer Chemoresistance. Cancer research, 74(8), 2258-2269.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!