Andor revolution xd spinning disk confocal system

To obtain transgenic plants expressing GFP-tagged α-tubulin, a pUbi-GFP-α-tubulin plasmid was constructed by inserting the coding sequences of rice α-tubulin (LOC_Os03g51600.1) and EGFP into the BamHI/SpeI and SpeI/BstEII sites of the pUN1301 vector59 , respectively. The rice α-tubulin fragment was RT-PCR amplified using primer pairs TubF (5′ GCCACTAGTATGAGGGAGTGCA TCTC 3′) and TubR (5′ATCGGTCACCCTAGTACTCGTCACCATC 3′). Transgenic WT and sar1 plants containing GFP-α-tubulin were obtained by plant transformation60 (link) using the Agrobacterium tumefaciens strain EHA105 harboring the constructed plasmid.
Root tips (about 1 cm) from one-month-old transgenic plants were incubated in PME at 23°C for at least 30 min and used to observe the behavior of individual microtubules in vivo with an Andor Revolution XD Spinning Disk Confocal System (Andor Technology). Cells with well-resolved individual microtubules (most of them were at the late elongation or differentiation stage) were used to analyze microtubule dynamics with the Image J software (http://imagej.nih.gov/ij/) according to the described method61 (link).

Four-dimensional data sets were collected with Andor Revolution XD spinning-disk confocal system (Andor Technology, Belfast, UK), equipped with an electron-multiplying charge-coupled device iXonEM Camera and a Yokogawa CSU 22 unit based on an Olympus IX81 inverted microscope (Olympus, Southend-on-Sea, UK). Two laser lines at 488 and 561 nm were used for the excitation of GFP and mCherry and the system was driven by Andor IQ software. Z-stacks (0.8–1.0 μm) covering the entire volume of the mitotic cells were collected every 1.5 min with a PlanApo ×60/1.4 NA objective. All images represent maximum-intensity projections of all z-planes. ImageJ/Fiji software was used to edit the movies.