Total cellular RNA was isolated from the blood samples in EDTA tubes using the MagNA Pure Compact RNA Isolation Kit (Roche Diagnostics, GmbH) on the automatic isolator MagNA Pure Compact (Roche Diagnostics, GmbH). 1 μg of RNA was used to synthesize cDNA using an ImProm-II Reverse Transcription System kit (Promega, Southampton, UK), according to the manufacturer’s instruction. The sequences of SIRT1, SIRT3, SOD2, and beta-actin (reference gene) primers were as stated in our previously published study [30 (link)]. The mRNA levels among the samples were normalized to the corresponding results of the internal control Beta-actin mRNA. A QuantiTect SYBR Green PCR kit (Qiagen, Manchester, UK) was used to perform the amplification in duplicate, in the iCycleriQ Real-Time PCR Detection System (Applied Biosystem, Cheshire, UK), following the manufacturer’s protocols. Relative expression quantification was calculated using Rest 2009 version 2.0.13 software [31 ].
Improm 2 reverse transcription system kit
Manufactured by Promega
Sourced in United States, United Kingdom
The ImProm-II Reverse Transcription System kit is a laboratory tool designed for the reverse transcription of RNA to cDNA. It includes the necessary components for the conversion of RNA into single-stranded complementary DNA (cDNA) for use in various downstream applications.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (18 mentions)
Dnase 1, by Thermo Fisher Scientific (4 mentions)
Sensimix sybr mix, by Meridian Bioscience (3 mentions)
Tri reagent, by Merck Group (3 mentions)
Quantitect sybr green pcr kit, by Qiagen (2 mentions)
Dreamtaq, by Thermo Fisher Scientific (2 mentions)
Sv minipreps dna purification kit, by Promega (2 mentions)
Sv total rna isolation kit, by Promega (2 mentions)
Rneasy mini kit, by Qiagen (2 mentions)
Spectrum plant total rna kit, by Merck Group (2 mentions)
Nanodrop spectrophotometer, by Thermo Fisher Scientific (2 mentions)
Lightcycler 480 real time pcr, by Roche (2 mentions)
Rneasy kit, by Qiagen (2 mentions)
Nanodrop 2000, by Thermo Fisher Scientific (2 mentions)
Magna pure compact rna isolation kit, by Roche (1 mentions)
Magna pure compact, by Roche (1 mentions)
Random primers dna labeling system kit, by Thermo Fisher Scientific (1 mentions)
Rotor gene q 2plex, by Qiagen (1 mentions)
C1000 thermal cycler, by Bio-Rad (1 mentions)
Sybr green pcr master mix, by Qiagen (1 mentions)
42 protocols using improm 2 reverse transcription system kit
1
Quantification of Sirtuin mRNA Levels
2
Genomic DNA and RNA Extraction Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The wild‐type and deletion mutants were cultured in liquid CM at 25 °C for 3 days to extract gDNA and total RNA, as described previously (Kong et al., 2015 ). The gDNA was digested at 37 °C with restriction enzymes, separated on a 1% agarose gel and transferred to a nitrocellulose membrane. The membrane was hybridized with p32‐labelled probe generated using a Random Primers DNA Labeling System kit (Invitrogen, California, USA), and exposed to X‐ray film. Total RNA (5 μg) was reverse transcribed to complementary DNA (cDNA) using an ImProm‐II Reverse Transcription System kit (Promega, Wisconsin, USA), and subjected to qRT‐PCR using 50 ng of cDNA, 3 μL of primers and 5 μL of SYBR Green PCR Master Mix in a Rotor‐Gene Q 2plex (Qiagen, Hilden, Germany). Transcript levels were quantified by RT‐PCR using 100 ng of cDNA, 3 μL of primers and 10 μL of 2X master mix in a C1000 thermal cycler (Bio‐Rad, California, USA).
3
Quantifying Arf6 Expression in BM-DCs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
BM-DCs on day 7 of differentiation were harvested, the pellets were collected, and the RNA was extracted using the NucleoSpin RNA XS kit (Macherey-Nagel). cDNA was obtained using the ImProm-II Reverse Transcription System kit (Promega), with random hexamers and 1 μg of total RNA. qPCR was performed with the SYBR Green method using Takyon ROX qPCR SYBR MasterMix blue dTTP (Eurogentec) and the following primers: GAPDH Fw: 5′-CCGTAGACAAAATGGTGAAGG-3′, GAPDH Rv: 5′-CGTGAGTGGAGTCATACTGGA-3′, Arf6 Fw: 5′-AGATCTTCGGGAACAAGGAAAT-3′, and Arf6 Rv: 5′-CACACGTTGAACTTGACGTTTT-3′. Relative gene expression of Arf6 was determined according to the 2(−ΔΔCT) method using the GAPDH housekeeping gene as a reference.
4
RNA Extraction and Reverse Transcription
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
TRIZOL (Invitrogen Life Technologies) – a reagent used in RNA extraction – was used to extract total RNA from the blood samples, in accordance with the standard method of acid-guanidinium-phenol-chloroform. After extraction, RNA was analyzed by agarose gel electrophoresis. The study was conducted only on the basis of cases with preserved 28S, 18S, and 5S ribosomal RNA bands with good RNA quality. DnaseI (GIBCO) was used to digest total RNA at room temperature for 15 min. Five micrograms of digested RNA were subject to reverse transcription at 42°C for a period of 60 min (total reaction volume of 20 ml) using the ImProm-II™ Reverse Transcription System kit (Promega, USA). The resulting cDNA was used in a real-time PCR reaction.
5
Quantification of Lentiviral Vector Integration
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DNA and RNA were isolated from muscle after tissue homogenization using the SV Total RNA isolation system (Promega) following the manufacturer’ instructions for isolation of both DNA and RNA. Standard curves for total and integrated IDLV DNA quantification in monkey’s muscle biopsies were generated using serial dilutions of genomic DNA extracted from CMMT macaca mulatta cells (ATCC CRL-6299) stably transduced with a neomycin resistant integrase-competent lentiviral vector-expressing GFP (CMMT-LV-Neo). The reference gene β-actin was used as loading control. 50 ng of RNA extracted from mice thigh muscles were reverse transcribed with random examer using the ImProm-II™ Reverse Transcription System kit (Promega) following the manufacturer instructions. Complementary DNA was amplified using GFP- and β-actin-specific primers with AmpliTaq Gold™ 360 Master Mix (Thermo Fisher Scientific). The C26 murine cell line constitutively expressing GFP was used as a positive control (C26/GFP). RT minus reactions were performed to exclude the presence of contaminating vector DNA. PCR reactions were performed using the primer sets and conditions showed in Supplementary Table 3 .
6
Quantifying VEGF, VEGF-C, and HIF-1α Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from SCCVII cells using Trizol reagent (Invitrogen, Carlsbad, CA, USA) according to the protocol supplied by the manufacturer. Two μg of total RNA were used for cDNA synthesis with an Improm-II Reverse Transcription System kit (Promega, Madison, WI, USA). The reverse transcription procedure was performed following the manufacturer-provided protocol in a 20 μL reaction mixture containing oligo(dT) primer. PCR products were obtained from Dream taq (Thermo Fisher Scientific Inc., Waltham, MA, USA), and 2 μL of cDNA was used for PCR with specific primers using mouse VEGF-A, 5′-GCCCTGAGTCAAGAGGACAG-3′ (forward) and 5′-GAAGGGAAGATGAGGAAGGG-3′ (reverse); mouse VEGF-C, 5′-CCACAGTGTCAGGCAGCTAA-3′ (forward) and 5′-ACTGCATGTTTGATGGTGGA-3′ (reverse); mouse Hif-1α, 5′-TGACGGCGACATGGTTTACA-3′ (forward) and 5′- AATATGGCCCGTGCAGTGAA-3′ (reverse); and mouse β-actin, 5′-ATGAAACTACATTCAATTCCATCAT-3′ (forward) and 5′-AAACAAAACAATGTACAAAGTCCTC -3′ (reverse). PCR products were resolved on 1% agarose/Tris-acetate EDTA gels that were electrophoresed then visualized with ethidium bromide. PCR product band intensity values were determined using the Image J program (NIH, version 1.51j8).
7
Validating Microarray Data via qRT-PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Validation of the microarray data using quantitative real-time PCR (qRT–PCR) was carried out in StepOnePlusTM RT-PCR System (ThermoFisher, Waltham, MA, USA). Total RNA isolated and quality checked for the microarray experiments was used for cDNA synthesis for the qRT–PCR experiments. Manufacturer’s protocol was followed for cDNA synthesis using ImProm-II™ Reverse Transcription System kit (Promega, Madison, WI, USA). The primer pairs listed in Table 1 were used for amplification of the appropriate target and endogenous control genes. All experiments were done in triplicates biological samples, data analyses were performed by Microsoft Excel 2010, and data were plotted by GraphPad Prism 8 (GraphPad Software, Inc., San Diego, CA, USA).
8
cDNA Synthesis from F. thermalis RNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
cDNA was synthetized from 1 µg of DNA-free RNA of F. thermalis PCC 7521 using the ImProm-II Reverse Transcription System kit (Promega, Madison, WI, USA) according to the manufacturer’s protocol. To improve the specific cDNA synthesis, we used a mix of reverse primers targeting the genes of interest [84 ]. Primers were designed using Primer3 [85 (link)] based on the F. thermalis NIES-3754 genome. Primers are listed in Table S6 .
9
Analysis of Osteogenic Differentiation in DPSCs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA from DPSCs, cultured in α-MEM, OM, OM + EGF and OM + bFGF was isolated using the TRIzol method (Invitrogen Corp, Carlsbad, CA, USA). For the cDNA synthesis, the ImProm-II Reverse Transcription System kit (Promega, Madison, WI, USA) was used according to the manufacturer’s instructions. PCR reactions to β-actin, alkaline phosphatase (ALP), bone sialoprotein (BSP), osteocalcin (OCN) and osteopontin (OPN) were performed in a MJ-Mini™ Staff Thermal cycler (Bio-Rad), following the protocol previously described [27 ]. PCR products were resolved on 1.5 % agarose gel electrophoresis, running at 100 V for 35 min. The gels were stained with 1 μg/ml ethidium bromide (Bio Basic Inc, Markham, ON, Canada) and displayed in a UV Transilluminator Doc™ Gel (Bio-Rad). All the reagents were used as a negative control for PCR except cDNA. In our study, all tests were performed three times (Table 1 ).
Primer sequences for osteogenic differentiation analysis using reverse transcriptase-polymerase chain reaction (RT-PCR)
| Gene | Sequence of oligonucleotides (5’- 3’) | Tm °C |
|---|---|---|
| β-Actin | Forward: GGCATCCTGACCCTGAAGTA Reverse: GGGGTGTTGAAGGTCTCAAA | 51 |
| OCN | Forward: GAGCCCCAGTCCCCTACC Reverse: CCGATAGAGGTCCTGAAAG | 58 |
| BSP | Forward: CAGCGGAGGAGACAATGGAG Reverse: TTCAACGGTGGTGGTTTTCC | 58 |
| OPN | Forward: CAACGAAAGCCATGACCACA Reverse: CAGGTCCGTGGGAAAATCAG | 54 |
| ALP | Forward: GGTGAACCGCAACTGGTACT Reverse: CCCACCTTGGCTGTAGTCAT | 54 |
10
APP Expression Regulation in Neuroblastoma
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The TRIzol RNA extraction reagent (Invitrogen Life Technologies) was used to extract total RNA from the brain of a patient with AD. Five micrograms of isolated RNA was reverse-transcribed at 42°C for 60 min using the ImProm-II™ Reverse Transcription System Kit (Promega, Madison WI, USA). The obtained cDNA was used to amplify the APP fragment coding the 240 C-terminal amino acids of human APP, which contains the predicted sites for cleavage by α, β, or γ-secretase. The APP fragment cDNA was amplified using an Expand High Fidelity PCR Kit (Roche Molecular Biochemicals Germany) and primers: 5′ TTTGGATCCATGACACACCTCCGTGTGATTTATGAGCG 3′, 5′ TTCTCGAGCTAGTTCTGCATCTGCTCAAAGAACTTGTAGG 3′ containing restriction sites for BamH1 and XhoI. The amplification fragment was cloned into a pTX-FLAG expression system, resulting in a high level of APP expression in bacterial cells. The APP-fragment was then recloned to the pCI-neo (Promega, Madison WI) mammalian expression system. The pCI-neo APP recombinant plasmid was used for transfection of the INR-32 human neuroblastoma cell line using lipofectamine reagent (Gibco-BRL, Bethesda MD., USA). Stable APP expression was obtained by selecting transfected cells with the antibiotic G418. A transfected INR-32 human neuroblastoma cell line with confirmed APP expression was then used as a model to study BACE1 expression and BACE1-siRNA selection.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!