To extract total RNA, cells were lysed with the TRIzol Reagent (Invitrogen Corporation, Carlsbad, CA, USA) and reversed into complementary DNA (cDNA) with the QuantiTect Reverse Transcription Kit (TaKaRa, Dalian, China). The sequences of the designed primers used for the real-time PCR (qRT-PCR) experiments were as follows: IFITM1 forward, 5′-AGCCAGAAGATGCACAAGGA-3′ and reverse, 5′-GATCACGGTGGACCTTGGAA-3′; GAPDH forward, 5′- GAAGGTCGGTGTGAACGGATTTG-3′ and reverse, 5′- CATGTAGACCATGTAGTTGAGGTCA-3′ (Sangon, Shanghai, China).
Quantitect reverse transcription kit
Manufactured by Takara Bio
Sourced in Japan, China
The QuantiTect Reverse Transcription Kit is a laboratory product designed for the reverse transcription of RNA into cDNA. It provides the necessary components for efficient and reliable conversion of RNA to cDNA, which can then be used for various downstream applications such as qPCR or PCR analysis.
Automatically generated - may contain errors
Lab products found in correlation
Trizol, by Thermo Fisher Scientific (7 mentions)
Trizol reagent, by Thermo Fisher Scientific (5 mentions)
Power sybr green pcr master mix, by Takara Bio (4 mentions)
Rnaiso, by Takara Bio (3 mentions)
7500 real time system, by Thermo Fisher Scientific (2 mentions)
Quantitect sybr green rt pcr kit, by Takara Bio (2 mentions)
Trizol regent, by Takara Bio (2 mentions)
Sybr green, by Takara Bio (2 mentions)
Specific primers, by Takara Bio (2 mentions)
Rna extraction kit, by Takara Bio (2 mentions)
Sybr green dye, by Takara Bio (2 mentions)
Abi 7500 fast system, by Thermo Fisher Scientific (1 mentions)
Sybr premix ex taq, by Takara Bio (1 mentions)
Abi prism 7300 system, by Thermo Fisher Scientific (1 mentions)
Rna kit, by Qiagen (1 mentions)
Mx3000ptm real time pcr system, by Agilent Technologies (1 mentions)
Viiatm 7 real time pcr system, by Thermo Fisher Scientific (1 mentions)
Sybr premix ex taq 2, by Takara Bio (1 mentions)
Lightcycler 480 system, by Roche (1 mentions)
Tb green, by Takara Bio (1 mentions)
26 protocols using quantitect reverse transcription kit
1
RNA Extraction and qRT-PCR Analysis
2
Real-time PCR Analysis of H19 and IGF2
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
First-strand cDNAs synthesized using the QuantiTect Reverse Transcription Kit were subjected to real-time PCR analysis using the SYBR Premix Ex Taq (RR420A, Takara) on an ABI7500fast system (Thermo-Fisher Scientific). The thermal cycling conditions used were the initial denaturation at 95 °C for 1 min, followed by the 40 cycles of 95 °C for 15 s and 60 °C for 60 s. The sequences of the PCR primers used are listed in Additional file 4: Table S2. The relative expression levels of H19 and IGF2 were calculated by the delta-delta cycle threshold (Ct) method. Delta Ct values were calculated using the Ct values of ACTB as the normalization control, and delta-delta Ct values corresponding to relative expression levels were calculated using a placenta sample of normal pregnancy as the reference.
3
Quantitative Analysis of TGF-β1 and α-SMA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA from each sample was extracted with the Trizol reagent (Invitrogen, USA). The RNA purity and quantity were measured by determining absorbance at 260 and 280 nm, and 1 μg of RNA was used as the template for cDNA synthesis using the QuantiTect Reverse Transcription Kit (TAKARA Biotechnology (Dalian) Co. Ltd., Dalian, China) according to the manufacturer's instructions. The primers for the target products were designed as shown in Supplementary Table S1 available online at https://doi.org/10.1155/2017/1798260 . Polymerase chain reaction (PCR) amplification was subsequently carried out in a PCR thermal cycler (Life Technologies, Carlsbad, California, USA). The PCR products were separated by 1.2% agarose gel electrophoresis containing gelred. Then, the images were acquired using a gel documentation system (Syngene GBox-HR Gel Doc System, UK). The quantitative real-time polymerase chain reaction (qRT-PCR) was performed to measure the mRNA levels of TGF-β1 and α-SMA (QuantiTect SYBR Green RT-PCR kit, TAKARA Biotechnology (Dalian) Co. Ltd.) with a 7500 Real Time System (Life Technologies, Carlsbad, California, USA). All PCR products were normalized to the expression levels of β-actin used as an internal standard.
4
Quantitative PCR Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Hepatocytes were collected from 25 cm2 flasks for the total RNAs extracted by TRIzol regent (TaKaRa, Japan). Reverse transcriptions were performed with equal quantities of each total RNA as template using Quantitect Reverse Transcription Kit (TaKaRa, Japan) for real-time PCR according to the manufacturer’s protocol. qPCR was carried out according to the methods described in our previous studies (Cheng et al., 2017 (link); Wei et al., 2018 (link)). The primer sequences of each gene used in this analysis are the same as Supplementary Table 2 . A set of 10 housekeeping genes (18S rRNA, β-actin, rpl7, tuba, b2m, elfa, gapdh, tbp, hprt, and ubce) were selected in order to test their transcriptional stability. The relative expression of genes was calculated by 2-ΔΔCt method and GeNorm was used to normalize the geometric mean of two best combination genes under different experimental conditions.
5
Quantitative Analysis of PJVK, NOD1, and IL18 Expression in Papillary Thyroid Carcinoma
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Sixty-five matched tumorous and non-tumorous tissue specimens of PTC were collected from the First Affiliated Hospital of China Medical University. The clinicopathological characteristics of 65 THCA patients from our hospital are displayed in Table 2 . Total RNA was extracted from tissue samples using RNAiso (Takara, Dalian, China), then RNA was reverse transcribed into cDNA with the QuantiTect Reverse Transcription Kit (Takara, Shiga, Japan). Quantitative Real-Time PCR (qRT-PCR) analyses were performed with SYBR-Green (Takara, Shiga, Japan) to validate gene expression, and the level of GAPDH served as an internal control. The relative expression was calculated based on the comparative Ct (2−ΔΔCt) method [28 (link)]. The primers’ sequences are listed in Table 3 .
The clinicopathological features of THCA (N = 65)
| Characteristics | Samples (N = 65) | Percentage (%) |
|---|---|---|
| Age | ||
| ≤ 60 | 58 | 89 |
| > 60 | 7 | 11 |
| Gender | ||
| Female | 46 | 71 |
| Male | 19 | 29 |
| Tumor size | ||
| < 2 cm | 42 | 65 |
| ≥ 2 cm | 23 | 35 |
| Extrathyroidal invasion | ||
| Yes | 8 | 12 |
| No | 57 | 88 |
| Multicentricity | ||
| Yes | 26 | 40 |
| No | 39 | 60 |
| Stage | ||
| Stage I–II | 59 | 91 |
| Stage III–IV | 6 | 9 |
| T | ||
| T1–2 | 44 | 68 |
| T3–4 | 21 | 32 |
| N | ||
| N0 | 20 | 31 |
| N1 | 45 | 69 |
Premier sequences for qRT-PCR analysis
| Premier | Sequences (5′–3′) |
|---|---|
| PJVK-F | GGAAGGCGAGGTAACCATATTG |
| PJVK-R | TTCTGCTGCTCCTTGACTGAC |
| NOD1-F | CGAGACACAGAGCCAGAAGGT |
| NOD1-R | CGCCGTAGTCGTTGAGATTGTT |
| IL18-F | AGTTCTCTTCATTGACCAAGGA |
| IL18-R | CATACCTCTAGGCTGGCTATCT |
| GAPDH-F | GTCTCCTCTGACTTCAACAGCG |
| GAPDH-R | ACCACCCTGTTGCTGTAGCCAA |
6
Evaluating HIF-1/HRE Pathway Activation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To evaluate whether the HIF-1/HRE pathway was activated and the function it served, we measured transcripts of HIF-1α and its downstream genes. At the end of reoxygenation, total RNA from cardiomyocytes was extracted with TRIzol using an RNA extraction kit (TaKaRa, Dalian, China), according to the manufacturer's instructions. The concentration and purity of the total RNA was determined by spectrophotometry at 260 and 280 nm, with an OD260/OD280 ratio between 1.8 and 2.0 suggesting that the total RNA was pure. Complementary DNA (cDNA) was synthesized from total RNA using the QuantiTect Reverse Transcription kit (TaKaRa). The mRNA levels of HIF-1α, VEGF, Bcl-2, and Bax were measured by RT-PCR, and the following specific primers were used (TaKaRa):
7
Quantifying XBP1S Expression via RT-qPCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
cDNA synthesis was performed with QuantiTect Reverse Transcription Kit (TaKaRa Biotech, Dalian, China). PCR was performed on an ABI prism 7500 with the Power SYBR Green PCR Master Mix (TaKaRa Biotech, China). β-actin was used as an endogenous control to normalize the amount of RNA. XBP1S forward: 5'-GCTTGTGATTGAGAACCAGG-3' and reverse: 5'-GGCCTGCACCTGCTGCGGACTC-3' β-actin forward: 5'-AGAGGGAAATCGTGCGTGAC-3' and reverse: 5'-TTCTCCAGGGAGGAAGAGGAT-3'.
8
Quantifying gene expression in GSCC cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from cultured GSCC cells using the RNA kit (Qiagen, Inc.) according to the manufacturer's protocol. Total RNA was reverse transcribed into cDNA using QuantiTect Reverse Transcription kit (Takara Bio, Inc.), according to the manufacturer's protocol. Primer sequences were as follow: p21, forward 5′-GAAAAGGAGAACACGGGATG-3′, reverse 5′-AAAGTCACTAAGAATCATTTATTG-3′; and β-actin, forward 5′-CGGAGTCAACGGATTTGGTC-3′ and reverse 5′-AGCCTTCTCCATGGTCGTGA-3′. RT-qPCR was performed using a TaqMan miRNA RT-qPCR assay (Takara Bio, Inc.) equipped with ABI-Prism 7300 system (Applied Biosystems; Thermo Fisher Scientific, Inc.). RT-qPCR thermocycling conditions were performed as follows: Denaturation at 95°C for 30 sec, followed by 45 cycles at 95°C for 3 sec and 60°C for 30 sec. Expression was quantified using the 2−ΔΔCq method (23 (link)).
9
Gene Expression Analysis of Mouse Tissues
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Mouse tissues were harvested and frozen immediately in liquid nitrogen and stored at −80 °C until use. cDNA was synthesized with QuantiTect Reverse Transcription Kit (Takara, China). Expression analysis of the reported genes was performed on BIO-RAD CFX96 with the Power SYBR Green PCR Master Mix (Takara, China). β-Actin was used to normalize sample amplification. Primers used are listed in Supplementary Table S1 online.
10
MAGE-A11 Expression in HNSCC
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
First, total RNA from 10 cases of HNSCC tissues and paired non-cancerous tissues were extracted by using TRIzol (Invitrogen, Carlsbad, CA, USA). Then, human immortal keratinocyte line (HaCaT), HNSCC cell lines (Cal27, Tca8113 and SCC9) were grown in a 6-well culture plate to 70–80% confluence before total RNA extraction with TRIzol (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s instructions. 500 ng total RNA were reverse transcribed to cDNA using QuantiTect Reverse Transcription Kit (TaKaRa, Shiga, Japan). The SYBR green dye (Takara, Shiga, Japan) was used for the amplification of cDNA. The mRNA levels of MAGE-A11, as well as that of the internal standard GAPDH, were measured by real-time quantitative PCR in triplicate using an Mx3000PTM Real-Time PCR System by Agilent (Stratagene, La Jolla, CA, USA). The specific primers used for these genes are listed in Table 1 .
Sequence of Primers
| Gene | Primers (F: Forward; R: Reverse) | Amplicon Size (bp) |
|---|---|---|
| MAGE-A11 | F: 5ʹ-TGAGCAAGGTGAGCACTATGT-3’ | 198 |
| R: 5ʹ-CCCACAGCACTTGTTCTCCT-3’ | ||
| GAPDH | F: 5ʹ-GTCGGAGTCAACGGATTTGG-3’ | 166 |
| R: 5ʹ-TGACGGTGCCATGGAATTTG-3’ |
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!