The largest database of trusted experimental protocols

Control mouse igg

Manufactured by Santa Cruz Biotechnology
Sourced in United States

Control mouse IgG is a laboratory reagent used as a control in various immunological experiments. It is a purified immunoglobulin G (IgG) isolated from normal mouse serum. Control mouse IgG serves as a reference or comparison point to help evaluate the specificity and performance of experimental antibodies or assays.

Automatically generated - may contain errors

41 protocols using control mouse igg

1

Immunoblotting for Protein Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
Mouse control IgG (Santa Cruz Biotechnology, sc-2025) and rabbit control IgG (Millipore, 12–370), HRP-conjugated goat-anti mouse or rabbit IgG (Thermo Scientific, PA1-86717 and SA1-9510) (1:3000), mouse anti-GFP (Sungene Biotech, KM8009) (1:2000), mouse anti-FLAG (KM8002) (1:2000), mouse anti-β-Actin (KM9001) (1:2000), mouse anti-HA (COVANCE, MMS-101R) (1:2000), anti-pIκBα (9246 L)(1:1000), anti-Ubiquitin (sc-8017) (1:500), anti-Ubiquitin, K48 specific (Merck, 05-1307), anti-IRF3 (sc-9082) (1:1000), anti-IκBα (sc-371) (1:1000), anti-p-IRF3 (4947 S) (1:1000), anti-TBK1 (GR96328-11) (1:2000) and anti-cGAS (sc-515777) (1:1000)were purchased from the indicated manufactures. LPS (Sigma, L2630) and CpG-B (Invivogen, tlr-1826) were purchased from the indicated manufactures. Poly(I:C), ISD45, DNA90, and HSV120 were previously described.35 (link) ISD45: 5′-TACAGATCTACTAGTGATCTATGACTGATCTGTACATGATCTACA-3′; DNA90: 5′-TACAGATCTACTAGTGATCTATGACTGATCTGTACATGATCTACATACAGATCTACTAGTGATCTATGACTGATCTGTACATGATCTACA-3′; HSV120: 5′-AGACGGTATATTTTTGCGTTATCACTGTCCCGGATTGGACACGGTCTTGTGGGATAGGCATGCCCAGAAGGCATATTGGGTTAACCCCTTTTTATTTGTGGCGGGTTTTTTGGAGGACTT-3′.
+ Open protocol
+ Expand
2

Western Blotting Antibody Reagents

Check if the same lab product or an alternative is used in the 5 most similar protocols
Mouse control IgG (Santa Cruz Biotechnology, sc-2025) and rabbit control IgG (Millipore, 12–370), HRP-conjugated goat-anti mouse or rabbit IgG (Thermo Scientific, PA1-86717 and SA1-9510)(1:3,000), mouse anti-GFP (Sungene Biotech, KM8009)(1:1,000), mouse anti-FLAG (KM8002)(1:2,000), mouse anti-β-Actin (KM9001)(1:1,000), mouse anti-HA (COVANCE, MMS-101 R)(1:2,000), anti-pIκBα (9246L)(1:1,000), anti-Ubiquitin (sc-8017)(1:1,000), anti-IRF3 (sc-9082)(1:500), anti-IκBα (sc-371)(1:500), anti-p-IRF3 (4947 S)(1:1,000), anti-USP13 (abcam, GR56969-12)(1:500), anti-TBK1 (GR96328-11)(1:1,000) and anti-STING (13647 S)(1:1,000) were purchased from the indicated manufactures. Poly(I:C), ISD45, DNA90 and HSV120 were previously described36 (link)37 (link)38 (link)39 (link). ISD45: 5′-TACAGATCTACTAGTGATCTATGACTGATCTGTACATGATCTACA-3′; DNA90: 5′-TACAGATCTACTAGTGATCTATGACTGATCTGTACATGATCTACATACAGATCTACTAGTGATCTATGACTGATCTGTACATGATCTACA-3′; HSV120: 5′-AGACGGTATATTTTTGCGTTATCACTGTCCCGGATTGGACACGGTCTTGTGGGATAGGCATGCCCAGAAGGCATATTGGGTTAACCCCTTTTTATTTGTGGCGGGTTTTTTGGAGGACTT-3′.
+ Open protocol
+ Expand
3

ChIP Assays for ORF34-Mediated Chromatin Regulation

Check if the same lab product or an alternative is used in the 5 most similar protocols
ChIP assays were performed as described previously42 (link). Briefly, iVero-ΔORF34/3xFLAG-ORF34 cells were treated with or without 8 μg/mL of Dox and 1.5 mM NaB for 72 hours. Soluble chromatin were prepared from formaldehyde-fixed cells by sonication and then subjected to immunoprecipitation with an anti-FLAG (M2) monoclonal antibody (Sigma-Aldrich) or a mouse control IgG (Santa-Cruz). Immunoprecipitates containing chromatin and viral DNA were subjected to SYBR green real-time PCR for measuring the levels of promoter DNA of ORF46/47 (E gene) or K8.1 (L gene). The levels of immunoprecipitated viral DNA were normalized to total input DNA. The sequences of qPCR primer sets for each ORF transcriptional start site of are noted in Supplementary Table S1.
+ Open protocol
+ Expand
4

PCSK9 Binding and Platelet Activation

Check if the same lab product or an alternative is used in the 5 most similar protocols
Recombinant human PCSK9, mouse monoclonal anti-PCSK9, and polyclonal goat IgG were from R&D Systems/BioTechne, Minneapolis, MN, USA. Anti-human CD62P-PE (clone AK4) and anti-human CD42b-APC (clone HIP-1) were from Biolegend (San Diego, CA, USA). LDL was purchased from Kalen Biomedical (Germantown, MD, USA). Mouse control IgG was procured from Santa Cruz Biotechnologies (La Jolla, CA, USA). Repatha (evolocumab) was from Amgen (Thousand Oaks, CA, USA) and conjugated with fluorescein isothiocyanate (FITC, Sigma-Aldrich/Merck, Darmstadt, Germany) by standard methods.
+ Open protocol
+ Expand
5

ChIP-seq analysis of KSHV Rta

Check if the same lab product or an alternative is used in the 5 most similar protocols
Briefly, chromatin DNA from 1 × 108 TREx- K-Rta BCBL-1 cells were used per assay and immunoprecipitated with 20 µg mouse anti-FLAG M2 (Sigma-Aldrich, F1804) or mouse control IgG (Santa Cruz Biotechnology, sc2025). 1 ng ChIP-enriched or input DNA was used to generate Illumina-compatible libraries with the KAPA LTP Library Preparation Kit (Kapa Biosystems, KR0453) according to the manufacturer’s recommendations. Libraries were submitted for sequencing (50-bp single read) on an Illumina HiSeq 2500 sequencing system. The ChIP-Seq data was aligned to the human hg19 reference genome assembly and reference KSHV genome sequence (Human herpesvirus 8 strain JSC-1 clone BAC16, GenBank: GQ994935.1) with Bowtie 261 (link). Peak finding was performed with the MACS2 (Model-based Analysis of ChIP-Seq 2) program64 (link) according to the standard parameters described in the developer’s manual. We used the default settings with a minimum FDR (q-value) cutoff of 0.05. The peaks and reads alignments were visualized using the Integrative Genomics Viewer (IGV) genome browser from the Broad Institute.
+ Open protocol
+ Expand
6

HUVEC Rbm38 Immunoprecipitation Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols
HUVECs underwent immunoprecipitation (IP) using mouse control IgG (Santa Cruz, USA, sc-2025). For IP, antibodies were coupled to DynabeadsTM (Invitrogen). 10 million cells were used for IP and separated for control and Rbm38 pulldown group.
+ Open protocol
+ Expand
7

Antibodies and Nucleic Acid Probes for Immunoblotting

Check if the same lab product or an alternative is used in the 5 most similar protocols
Mouse control IgG (Santa Cruz Biotechnology, sc-2025) and rabbit control IgG (Millipore, 12–370), HRP-conjugated goat-anti mouse or rabbit IgG (Thermo Scientific, PA1-86717 and SA1-9510) (1:3000), HRP-conjugated mouse anti-FLAG (Sigma, A8592)(1:1000), mouse anti-FLAG (Sungene, KM8002)(1:2000), anti-GFP (Sungene, KM8009)(1:2000) anti-β-Actin (KM9001)(1:2000), anti-Tubulin (KM9003), anti-GAPDH(KM9002), anti-HA (COVANCE, MMS-101R)(1:2000), anti-Ubiquitin (sc-8017)(1:500), anti-Ubiquitin K63-specific linkage (Millipore 05–1308)(1:500), rabbit anti-TBK1(Abcam, 96328–11), anti-p-TBK1(Abcam, 109272), anti-IRF3 (sc-9082)(1:1000), anti-p-IRF3 (Cell Singling Technologies, 4947S)(1:1000), anti-IκBα (sc-371)(1:1000), anti-p-IκBα (Cell Singling Technologies, 9246L)(1:1000), anti-USP49 (proteintech,18066-1-AP), anti-mouse MITA and anti-human MITA (Cell Singling Technologies,13647) (proteintech, 19851-1-AP) were purchased from the indicated manufactures. ISD45, DNA90, and HSV120 were previously described [44 (link), 45 (link), 72 (link), 73 (link)]. ISD45: 5’-TACAGATCTACTAGTGATCTATGACTGATCTGTACATGATCTACA-3’; DNA90: 5’-TACAGATCTACTAGTGATCTATGACTGATCTGTACATGATCTACATACAGATCTACTAGTGATCTATGACTGATCTGTACATGATCTACA-3’; HSV120: 5’-AGACGGTATATTTTTGCGTTATCACTGTCCCGGATTGGACACGGTCTTGTGGGATAGGCATGCCCAGAAGGCATATTGGGTTAACCCCTTTTTATTTGTGGCGGGTTTTTTGGAGGACTT-3’.
+ Open protocol
+ Expand
8

Immunoprecipitation Assay for Aldolase C 9F mAb

Check if the same lab product or an alternative is used in the 5 most similar protocols
To test the 9F mAb in immunoprecipitation (IP) assays, the input sample consisted of adult mouse brain total protein extract (1mg) and was pre-cleared by incubation (1h at 4 °C on a rotating wheel) with 2μg of mouse control IgG (Santa Cruz Biotechnology, sc-2025). The solution was then incubated with 50µl of slurry Protein A/G plus-agarose beads (Santa Cruz Biotechnology, sc-2003) for 1h at 4 °C on a rotating wheel and subsequently centrifuged at 4000xg for 5min at 4 °C. The resulting supernatant was incubated with 10μg of the anti-aldolase C 9F mAb for 1h on a rotating wheel at 4 °C. Then, 50µl of fresh Protein A/G plus-agarose beads were added to the test tube and incubated for 2h at 4 °C. After extensive washing of the pellet beads, the resulting immunoprecipitated complex was eluted incubating the resin at 99 °C for 5min in 40µl of 2X protein sample buffer. Immunoprecipitation lysis buffer was constituted by 10% glycerol, 50mM TRIS-HCl pH 8, 150mM NaCl, 0.1–1% NP40, 1X Complete Roche Protease inhibitors, 0.5mM PMSF. For western blot analysis 1/10 of the total immunoprecipitated fraction was assayed. The 9F mAb was used also in the immunoblot analysis of the immunoprecipitation result.
+ Open protocol
+ Expand
9

Androgen Receptor Immunoprecipitation from Brain Nuclear Extracts

Check if the same lab product or an alternative is used in the 5 most similar protocols
Brain nuclear extracts (prepared as described above) were diluted to achieve a final buffer composition of 10 mM Tris-HCl pH 8.0, 150 mM NaCl, 0.1% SDS (supplemented with protease and phosphatase inhibitors as above) and then rotated on a rotary platform for 30 min at 4°C. Samples were centrifuged at 15,000 x g for 15 min and the supernatant was subjected to immunoprecipitation as follows. Two milligrams of nuclear extracts (in 2 ml) were incubated with 20 µg of anti-androgen receptor antibody (G122-434, BD Biosciences) or mouse control IgG (Santa Cruz Biotechnology) (crosslinked to Dynabeads M-270 Epoxy (Invitrogen) according to the manufacturer’s instructions) and incubated with rotation overnight at 4°C. Antibody-bound beads were washed 4 times with 1 ml of the same buffer, and then resuspended in 30 µl of 2 x Laemmli buffer, followed by SDS-PAGE and immunoblotting.
+ Open protocol
+ Expand
10

Signaling Pathway Antibody Procurement

Check if the same lab product or an alternative is used in the 5 most similar protocols
Recombinant IL-17A (mouse and human) were purchased from PeproTech (PeproTech, Rocky Hill, NJ, USA); human IL-17F (11855-HNAE), IL-1β, and TNF-α were purchased from Sino Biological Inc.; Primary antibodies against P-P65 (3033S), P-P38 (4511S), P-ERK1/2 (4370S), P-JNK (9251S), P-IκBα (2859), P-IKKα/β (2697), P-TAK1 (4508), IκBα (4814), P65 (8242), P38 (8690), and ERK1/2 (4695) were purchased from Cell Signaling Technology. Primary antibodies for Stk24 were purchased from Abcam (ab155198), IKKα/β (sc-7607), IKKγ (sc-8330), and mouse control IgG were purchased from Santa Cruz Biotechnology. Anti-Flag (M2) beads were purchased from Sigma. Antibodies against Flag, HA, Myc, and anti-HA beads were purchased from Abmart. Antibody for GADPH (M130718) was purchased from Huabio. PEI was purchased from Polyscience. INTERFERin@ was purchased from Polyplus Transfection.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!