Aceq sybr qpcr master mix

Firstly, the collected RNA was fragmented. Secondly, protein A magnetic beads (Thermo Fisher Scientific, Waltham, MA, USA) were incubated with anti-m⁶A antibody (abcam, Cambridge, UK) at room temperature for 1 h. Thirdly, the recovered RNA fragments were co-incubated with the mixture of magnetic beads and antibodies at 4 °C for 3 h. Fourthly, the above mixture was eluted with elution buffer, and the collected RNA was reverse-transcribed by HiScript reverse transcriptase. Lastly, the corresponding mixture of cDNA was configured according to AceQ SYBR^® qPCR Master Mix (Vazyme), and the expression levels of BCL2 and TLR4 were detected using a ViiA7 Real-Time PCR System instrument. The percentage input method was used for data analysis, where % input = 2^{−(Average CTRIP − AverageCTinput − log2(input dilution factor))}. Related primer sequences were as follows: TLR4 F, CCGGCTGGTTTTGGGAGAAT and R, ATGGTCAGGTTGCACAGTCC; BCL2 F, CAGTTGCTCTGCTGTTTGAGG and R, CATTACTCTAGTGCTCCCCGC.

Total RNA in tissue specimens and cultured cells was isolated using TRIzol™ Plus RNA Purification Kit (Thermo Fisher). Isolation of cytoplasmic and nuclear RNA from NSCLC cells was performed using the Cytoplasmic & Nuclear RNA Purification Kit (Norgen, Thorold, ON, Canada) in accordance with the manufacturer’s operating procedures. For RNase R digestion, total RNA derived from NSCLC cells was digested with 3 U/mg RNase R (Thermo Fisher). The reverse transcription reaction was performed using the HiScript III 1st Strand cDNA Synthesis Kit (Vazyme, Nanjing, China) or miRNA 1st Strand cDNA Synthesis Kit (Vazyme). After mixing AceQ SYBR qPCR Master Mix (Vazyme) with complementary DNA, qPCR was run on the Roche Applied Science LightCycler^TM 480 (Roche, Basel, Switzerland). Relative RNA levels of genes were calculated by the 2^−ΔΔCt method using U6 or GAPDH as the reference gene for normalization. Primer sequences are listed in Table 1.

Total RNA was collected from tumor tissues using an Animal Total RNA Isolation Kit (Foregene Co., Ltd, China) following the manufacturer’s protocol. cDNA was prepared using HiScript II Q RT SuperMix for qPCR (+gDNA Wiper) (Vazyme Biotech Co., Ltd., China). The qPCR was performed with AceQ SYBR qPCR Master Mix (Vazyme Biotech Co., Ltd., China) and the gene expression was normalized to the housekeeping gene ActB.

Total RNA was extracted by TRIzol reagent (Ambion, USA). Nest, reversed transcription of RNA to cDNA using the PrimeScript™ RT MasterMix kit (Takara, Japan). qRT-PCR was performed using AceQ SYBR qPCR Master Mix (Vazyme, China) according to the manufacturer’s instructions. The primers sequences are used as follows: CYB561 forward primer: GTCTTCAGGAACGAAGCTAAAC, reverse primer: CTTCTTCCTGTGGTAGTCGAAC. H2AFY forward primer: TGCTGCGGTACAT CAAGAAAGGC, reverse primer: CCCCACTGGCTATGGTGACTCC.

Total RNA was extracted by RNeasy Mini Kit (QIAGEN, Hilden, Germany) from 10 × 10⁶ bone marrow or spleen cells previously lysed in RLT buffer (QIAGEN) supplemented with 1% β-mercaptoethanol (Sigma-Aldrich, St. Louis, MO, USA) and stored at −80 °C. RNA was treated with DNA-free DNase Treatment and Removal Reagents (Ambion, Austin, TX, USA). DNase-treated total RNA (1 µg) was reverse transcribed with oligo(dT) and TaqMan Reverse Transcription Reagents (Thermo Fisher Scientific, Waltham, MA, USA). The resulting cDNA was diluted tenfold before use. Real-time quantitative PCR was performed in technical triplicates using AceQ SYBR qPCR Master Mix (Vazyme Biotech Co., Nanjing, China) and the corresponding primers (Supplementary Table 1) using a ViiA 7 Real-Time PCR System (Thermo Fisher Scientific). All RT–qPCR analyses were performed on an Applied Biosystems QuantStudio Software V1.3 (Thermo Fisher Scientific). Primer set efficiency was firstly calculated in a standard curve experiment. Relative gene expression levels were calculated using the comparative C_T method. Since target and housekeeping primer set efficiencies differed >10%, we applied the corrective formula described in [21 (link)] to calculate the relative expression ratio. Gene expression levels were then normalized to that of Hprt.

HiScript reverse transcriptase (Vazyme, Nanjing, China) was used to reverse-transcribe the RNA samples. The corresponding mixture of cDNA was configured according to AceQ SYBR^® qPCR Master Mix (Vazyme), and the expression levels of IL-1β, IL-6, and TNF-α were detected using a ViiA7 Real-Time PCR System (Applied Biosystems Inc., Foster, CA, USA) instrument. The 2^−ΔΔCt method was used for data analysis. Related primer sequences were as follows: β-actin F, AGATCAAGATCATCGCGCCC and R, TAACGCAGCTAACAGTCCGC; IL-1β F, TTCCATATTCCTCTTGGGGTAGA and R, AAATGAACCGAGAAGTGGTGTT; IL-6 F, CAGCAGGTCAGTGTTTGTGG and R, CTGGGTTCAATCAGGCGAT; TNF-α F, TCTTCTCAAGCCTCAAGTAACAAGC and R, CCATGAGGGCATTGGCATAC.

The following experiments were performed in accordance with the manufacturer's instructions (Millipore, Bedford, MA, USA): (1) total RNA was fragmented by Zn²⁺ at 94°C; (2) magnetic beads (Thermo Fisher Scientific, Waltham, MA, USA) and m⁶A antibody (Abcam, Cambridge, UK) were incubated for 1 h at room temperature; (3) the system was incubated with the fragmented RNA at 4°C for 2 h; (4) elution buffer was used to elute the mixture twice at 4°C for 1 h; and (5) the collected eluate was subjected to RNA extraction and reverse transcription (Vazyme). In accordance with manufacturer's the instructions, cDNA was detected by RT-qPCR using the AceQ SYBR qPCR Master Mix (Vazyme). The data were analyzed by % input; that is, %input = 2^−(Average CT_RIP − Average CT_input − log₂^{(input dilution factor)}). CT_RIP means the CT value of the RNA immunoprecipitation (IP RNA) samples, and CT_input means the CT value of the input RNA samples. The primers for the relevant methylated RNA were as follows (Table 2).