Luna probe one step rt qpcr kit

A PhoPeV-specific real-time reverse transcription PCR (qRT-PCR) was developed to screen for the novel pestivirus in stranded harbour porpoises from the North Sea. The primers and probe were designed to target the NS3 region of PhoPeV, with 5′-aaccatctgagtgtgaccttgagtc-3′ as forward primer, 5′-tcaatcaaccttcttggtagctcagtg-3′ as reverse primer, and 5′-tttaaacaagtgaccctggccaccgg-3′ as probe labelled with FAM-BHQ-1. Samples were homogenized, centrifuged and supernatants taken for RNA extraction. Automated sample processing was performed with a QIAcube instrument using the QIAmp Viral RNA Mini kit (Qiagen). A 45 cycle one-step qRT-PCR with annealing temperature of 57°C was carried out following the Luna Probe One-Step RT-qPCR kit (NEB) protocol. All available tissue samples from PhoPeV NGS-positive harbour porpoises were analysed using the newly developed qRT-PCR. An additional 109 kidneys from wild harbour porpoises that had stranded dead or alive along the Dutch North Sea coast and when alive had been nursed in the Dutch rehabilitation centre SOS Dolfijn for variable periods of time before dying, were also screened using this methodology. Spleen and brain tissue samples (if available) were also included from animals in which the kidney was found to be PhoPeV PCR-positive.

A systemic CDV infection was verified by reverse transcription PCR (forward primer ACAGGATTGCTGAGGACCTAT, reverse primer CAAGATAACCATGTACGGTGC [35 (link)]), in multiple tissue types of the infected fox by a OneStep RT-PCR Kit (Qiagen, Hilden, Germany). Screening of different organ material for CaKV RNA was performed using a newly developed virus-specific reverse transcription-quantitative PCR (RT-qPCR). Oligonucleotides were designed to target a 120 bp region (6764–6883 bp) of the CaKV genome. The resulting primers (forward primer 5′-atgaccgYcgtctcaaYgRtgg-3′, reverse primer 5′-tRgaRaagtagaggtcagcagc-3′) and the probe (5′-FAM-ttcctcaaacacggcaaaggtgatcagacc-BHQ1-3′) were then used in a 45-cycle one-step qRT-PCR with an annealing temperature of 57 °C and a Luna Probe One-Step RT-qPCR kit (NEB, Ipswich, MA, USA) according to the recommended protocol. To prepare the nucleic acids of the available samples for the PCR assays, organ tissue was homogenized using a FastPrep-24 5G homogenizer (MP Biomedical, Irvine, CA, USA), centrifuged (12,000× g for 5 min), and the supernatant used for RNA extraction with TRIzol^TM Reagent (Thermo Fisher Scientific, Waltham, MA, USA) following the manufacturer’s instructions.

In this study, we designed a multiplex PCR test that was performed on the LabTurbo AIO 48 system using specific primers and probes to simultaneously detect SARS-CoV-2, influenza A/B virus, and RSV in a well. The total viral nucleic acid was extracted from each swab in a universal viral transport medium (500 μL) to a final eluate volume of 60 μL using the LabTurbo Virus Mini Kit (Cat. No. LVN48-300) and an automated LabTurbo AIO open system. The Luna^® Probe One-Step RT-qPCR Kit (No ROX, New England Biolabs), comprising reverse transcriptase and 2× PCR master mix, was used according to the RNA testing kit instructions. For analysis on the LabTurbo AIO open system, each 25-μL reaction mixture contained 12.5 μL of 2× PCR master mix, 4 μL of primer/probe mixture, 1.25 μL of reverse transcriptase, 1.25 μL of RNase-free water, and 6 μL of extracted RNA. SARS-CoV-2, influenza A/B virus, and RSV were detected using the following thermal cycling conditions: 50°C for 10 min, 95°C for 2 min, and 45 cycles at 95°C for 10 s, 55°C for 25 s, and 64°C for 32 s. Here, we detected the N2 gene in the SARS-CoV-2 genome, M gene in influenza A/B virus, N gene in RSV, and human ribonuclease P gene (RP) [25 (link)], which was also included as an internal control (Supplementary Table 2).