The targeting relationship between lnc-CDHR and miR-3149 was validated by using the PmirGLODual-Luciferase miR target expression vector (Promega). Co-transfection of 293T cells with miR-3149 mimics or miR-Control was performed with pmirGLO-CDHR or pmirGLO-GAS-mut (miR-3149). We then verified the targeting relationship between PTEN and miR-3149. The wild-type reporter construct pmirGLO-PTEN or the mutant reporter construct pmirGLO-PTEN-mut(miR-3149) was co-transfected with miR-3149 mimic or miR-Control in 293T cells. After 48 hours of transfection, a dual luciferase reporter system (Promega) was used to measure the luciferase activity of each group of cells. Each experiment was repeated at least three times.
Pmirglo dual luciferase mir target expression vector
Manufactured by Promega
Sourced in United States
The PmirGLO Dual-Luciferase miR Target Expression Vector is a plasmid-based system designed for the study of microRNA (miRNA) target interactions. The vector contains a firefly luciferase reporter gene that can be used to monitor the effects of miRNA-target interactions on gene expression. The vector also includes a Renilla luciferase reporter gene that serves as an internal control. This system allows for the quantitative analysis of miRNA-mediated regulation of target gene expression.
Automatically generated - may contain errors
Lab products found in correlation
Dual luciferase reporter assay system, by Promega (4 mentions)
Dual glo luciferase assay system, by Promega (3 mentions)
Dual luciferase reporter system, by Promega (1 mentions)
Glomax navigator microplate luminometer, by Promega (1 mentions)
Dual luciferase reporter dlr assay system, by Promega (1 mentions)
Lipofectamine 3000 reagent, by Thermo Fisher Scientific (1 mentions)
Fetal bovine serum (fbs), by ScienCell (1 mentions)
Pmirglo, by Promega (1 mentions)
Quikchange xl site directed mutagenesis kit, by Agilent Technologies (1 mentions)
Oligofectamin transfection reagent, by Thermo Fisher Scientific (1 mentions)
Hek293t cell, by American Type Culture Collection (1 mentions)
Lipofectamine 2000 reagent, by Thermo Fisher Scientific (1 mentions)
Dual luciferase reporter gene assay system, by Promega (1 mentions)
10 protocols using pmirglo dual luciferase mir target expression vector
1
Validating lnc-CDHR and miR-3149 Interaction
2
Validating lncRNA-miRNA Binding Interactions
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Based on bioinformatic prediction [24 (link)], 6 miRNAs were selected as candidate targets of lncRNA-HGBC. pmirGLO Dual-Luciferase miR Target Expression Vector (Promega) was used to assess the direct binding of potential miRNAs to lncRNA-HGBC. The wild-type reporter construct pmirGLO-HGBC or the mutant reporter construct pmirGLO-HGBC-mut(miR-502-3p) was cotransfected with miR-502-3p mimic or miR-Control in 293 T cells. After transfection for 24 h, Firefly luciferase levels were measured using a Dual-Luciferase Reporter Assay System (Promega, Wisconsin) and normalized to Renilla luciferase activity. Each experiment was repeated at least three times.
3
Assessing miR-587 Binding to RNF185 3'UTR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
PmirGLO Dual-Luciferase miR Target Expression Vector (Promega) was used to assess the direct binding of miR-587 to RNF185 3′UTR. The wild-type reporter construct pmirGLO-RNF185-WT or the mutant reporter construct (pmirGLO-RNF185-MUT) with miR-587 inhibitors were co-transfected in 293T cells. After transfection for 24 h, firefly luciferase levels were measured using a Dual-Luciferase Reporter Assay System (Promega, Wisconsin) and normalized to Renilla luciferase activity. Each experiment was repeated at least three times.
4
Luciferase Assay for miR-16-5p Binding
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The Sesn1 3ʹ-untranslated region (3ʹ-UTR) with the miR-16-5p binding site was cloned into the pmirGLO Dual-Luciferase miR Target Expression Vector (E1130, Promega). The following oligonucleotide pairs were designed, annealed, and ligated into the pmirGLO Vector to generate WT and mutant luciferase constructs: WT forward primer, 5ʹ-AAACTAGCGGCCGCTAGTTGAGTGGCGCTCGGTGCTGCTGT-3ʹ, WT reverse primer, 5ʹ-CTAGACAGCAGCACCGAGCGCCACTCAACTAGCGGCCGCTAGTTT-3ʹ, mutant forward primer, 5ʹ-AAACTAGCGGCCGCTAGTTGAGTGGCGCTCGGTTAAGCTGT-3ʹ, and mutant reverse primer, 5ʹ-CTAGACAGCTTAACCGAGCGCCACTCAACTAGCG GCCGCTAGTTT-3ʹ. SNL cells seeded in 96-well plates were transfected with 0.1 μg of a luciferase plasmid along with either 50 nM of miR mimic control or miR-16-5p mimic. At 48 h after transfection, the transfected SNL cells were used to evaluate luciferase activities in Firefly and Renilla buffers measured with the Dual-Glo Luciferase Assay System (E2920, Promega) with the GloMax® Navigator Microplate Luminometer (Promega).
5
Luciferase Assay for DPP-4 3'UTR Activity
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For the luciferase assay, to analyze the activity of the 3′UTR in human DPP-4, we cloned the fragment of human DPP-4 3′UTR sequence by PCR with the primer set (Fw: ATAGAGCTCAATAGCTAGCAGCACAGCACACCAAC Rev: ATATCTAGA GTGTCCATATGCCAGTGCGGTTTAGG) and BAC clone human RP11 178A14 as a template. The purified PCR fragment and pmirGLO Dual-Luciferase miR Target Expression Vector (Promega) were enzyme digested (Sac-1 and Xba-1), purified, and ligated (Thermo Fisher Scientific, Waltham, MA). The sequence of DPP-4 3′UTR was confirmed, and the amplified vector DNA (300 ng/well in a 12-well plate) was transfected into HMVEC cells. In the presence and absence of TGF-β2, AcSDKP was stimulated (100 nM in final concentration); the transcript in the transcriptional activity was evaluated with the Dual-Luciferase® Reporter (DLR™) Assay System (Promega) in triplicate samples.
6
Dual Luciferase Assay for miRNA Targeting
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Specific culture medium was prepared by mixing DMEM, 10% FBS (ScienCell Research Laboratories, Inc.), 1% nonessential amino acids, 1% L-glutamine and 1% penicillin with streptomycin. 293T cells (National Infrastructure of Cell Line Resource) were seeded into 12-well plates (5×104 cells/cm2) and cultured in specific medium at 37°C in 5% CO2.
The pmirGLO dual luciferase miR target expression vector (pmirGLO), containing both firefly and Renilla luciferase genes was purchased from Promega Corporation. Human CREBBP 3′-untraslated region (3′-UTR), including the predicted binding site of miR-330-3p, was amplified via RT-PCR and inserted into the 3′-UTR downstream of the firefly luciferase gene in the pmirGLO vector (pmirGLO-UTR) using XbaI and SacI restriction sites. The QuikChange XL Site-Directed Mutagenesis kit (Agilent Technologies, Inc.) was used to construct the mutant miR-330-3p-binding site vector (pmirGLO-UTR-MUT) according to the manufacturer's protocol. Restriction enzyme digestion and sequencing was performed to validate the constructs. After cellular transfection for 36 h, luciferase activity was assessed with Lipofectamine™ 3000 reagent (Invitrogen; Thermo Fisher Scientific, Inc.) using a Dual-Glo luciferase assay system (Promega Corporation). Firefly luciferase activity was normalized to Renilla luciferase activity.
The pmirGLO dual luciferase miR target expression vector (pmirGLO), containing both firefly and Renilla luciferase genes was purchased from Promega Corporation. Human CREBBP 3′-untraslated region (3′-UTR), including the predicted binding site of miR-330-3p, was amplified via RT-PCR and inserted into the 3′-UTR downstream of the firefly luciferase gene in the pmirGLO vector (pmirGLO-UTR) using XbaI and SacI restriction sites. The QuikChange XL Site-Directed Mutagenesis kit (Agilent Technologies, Inc.) was used to construct the mutant miR-330-3p-binding site vector (pmirGLO-UTR-MUT) according to the manufacturer's protocol. Restriction enzyme digestion and sequencing was performed to validate the constructs. After cellular transfection for 36 h, luciferase activity was assessed with Lipofectamine™ 3000 reagent (Invitrogen; Thermo Fisher Scientific, Inc.) using a Dual-Glo luciferase assay system (Promega Corporation). Firefly luciferase activity was normalized to Renilla luciferase activity.
7
Twist1 3'UTR Luciferase Assay
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Constructs bearing 713 base pairs of murine Twist1 3′ untranslated region (UTR) were sub-cloned in pmiRGLo Dual-Luciferase miR Target expression Vector (Promega, Madison, WI, USA). COS7 cells maintained in DMEM, with 10% FBS, 100 µg/mL Penicillin/Streptomycin, 10 µg/mL gentamycin, 100 µg/mL l -glutamine, and seeded in 48-well plates (24,000 cells/well) were transfected with the reporter plasmid containing Twist-1 3′ untranslated region (UTR) using X-tremeGene 9 DNA transfection reagent followed by co-transfection with mmu-miR-337-3p precursor or LNA inhibitor or precursor scrambled miR negative control or LNA inhibitor negative control using oligofectamin transfection reagent (Invitrogen), as previously described. After 48 h, the luciferase activity was quantified using a Dual-Glo luciferase assay system (Promega) on a Luminometer. Firefly luciferase activity was normalized to renilla luciferase activity as an internal control.
8
Validating lncRNA GAS5 and PTEN Targeting by miR-21
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
PmirGLO Dual-Luciferase miR Target Expression Vector (Promega) was used to verify the targeting relationship between lncRNA GAS5 and miR-21. The wild-type reporter construct mirGLO-GAS5 or the mutant reporter construct pmirGLO-GAS-mut (miR-21) was co-transfected with miR-21 mimic or miR-Control in 293 T cells. Then we verified the targeting relationship between PTEN and miR-21. The wild-type reporter construct pmirGLO-PTEN or the mutant reporter construct pmirGLO-PTEN-mut (miR-21) was co-transfected with miR-21 mimic or miR-Control in 293 T cells. After transfection for 48 h, the luciferase activity of each group of cells was detected using a Dual-Luciferase Reporter Assay System (Promega). Each experiment was repeated at least three times.
9
Validating miR-185-3p regulation of MAML1
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The wild-type (WT) or mutant (MUT) 3'UTR sequences of MAML1 with the predicted miR-185-3p binding sites were cloned into the downstream of luciferase gene in the pmirGLO dual luciferase miR target expression vector (Promega, WI, USA) and named as MAML1-WT and MAML1-MUT. For the dual luciferase reporter gene assay, human embryonic kidney cells (HEK293T cells) (ATCC, Manassas, VA, USA) were seeded into 96-well plates and subjected to co-transfection with MAML1-WT, MAML1-MUT, mimic NC, or miR-185-3p mimic using the Lipofectamine 2,000 reagent (Invitrogen, CA, USA), which were respectively named as the mimic NC + MAML1-WT group, the miR-185-3p mimic + MAML1-WT group, the mimic NC + MAML1-MUT group, and the miR-185-3p mimic + MAML1-MUT group. Cells were obtained after 48-h post-transfection. The luciferase activity of firefly and renilla was assessed through the dual luciferase reporter gene assay system (Promega). The renilla luciferase activity was used for standardization [19] . The original measurements used for the quantifications of the experiments are shown in online supplementary Table 2.
10
Investigating miR-587 Regulation of RNF185 3'UTR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
PmirGLO Dual-Luciferase miR Target Expression Vector (Promega) was used to assess the direct binding of miR-587 to RNF185 3'UTR. The wild-type reporter construct pmirGLO-RNF185-WT or the mutant reporter construct (pmirGLO-RNF185-MUT) with miR-587 inhibitors were co-transfected in 293 T cells. After transfection for 24 h, re y luciferase levels were measured using a Dual-Luciferase Reporter Assay System (Promega, Wisconsin) and normalized to Renilla luciferase activity. Each experiment was repeated at least three times.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!