Trizol one step method

Manufactured by Thermo Fisher Scientific

Sourced in United States

TRIzol is a one-step method for the isolation of total RNA, DNA, and proteins from a variety of biological samples. It is a monophasic solution of phenol and guanidine isothiocyanate that maintains the integrity of RNA while disrupting cells and dissolving cell components.

Automatically generated - may contain errors

Lab products found in correlation

Nucleic acid protein analyzer, by Beckman Coulter (1 mentions) Quantitative sybr green pcr kit, by Qiagen (1 mentions) Mx4000 quantitative pcr system, by Agilent Technologies (1 mentions) Primescript rt pcr kit, by Takara Bio (1 mentions) Stem loop rt qpcr taqman microrna assays, by Thermo Fisher Scientific (1 mentions) Mirna qrt pcr starter kit, by RiboBio (1 mentions) Nanodrop nd 2000 spectrophotometer, by Thermo Fisher Scientific (1 mentions) Sybr premix ex taq 2, by Takara Bio (1 mentions) Real time pcr kit, by Takara Bio (1 mentions) Cdna synthesis kit, by Takara Bio (1 mentions) Sybr premix ex taq 2 kit, by Takara Bio (1 mentions) Primescript rt reagent kit, by Takara Bio (1 mentions) 7500 real time pcr system, by Thermo Fisher Scientific (1 mentions) Pcr primers, by Sangon (1 mentions)

6 protocols using trizol one step method

Quantitative Gene Expression Analysis in Brain and Stem Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

The Trizol one-step method (Invitrogen, Carlsbad, CA, USA) was implemented to extract the total RNA in brain tissues and BMSCs. The complementary DNA (cDNA) was obtained by avian myeloblastosis virus (AMV) reverse transcriptase after obtaining l μg RNA. SYBR Green was used for qPCR, and glyceraldehyde phosphate dehydrogenase (GAPDH) was selected as an internal control. PCR primer was designed and synthesized by Invitrogen (Carlsbad, CA, USA) (Table 1). RT-qPCR instrument (ABI 7500, ABI, Foster City, CA, USA) was used for detection. The 2^−ΔΔCt method was used to analyze the ratio relation of target gene expression between the experimental group and the control group. The experiment was repeated in triplicate.Table 1

Primer sequence

Gene	Sequence
XIAP	F: 5′-CCCTTGGGAACAGCATGCTA-3′
XIAP	R: 5′-AATCCAGCACCACAGTAGGC-3′
GFAP	F: 5′-AGGCCTAGGCATCTGGAAGA-3′
GFAP	R: 5′-ATCCTTCTGAGGCCCTCCAT-3′
GAPDH	F: 5′-CAGCCGCATCTTCTTGTGC-3′
GAPDH	R: 5′-GGTAACCAGGCGTCCGATA-3′

F forward, R reverse, XIAP X-linked inhibitor of apoptosis protein, GFAP glial fibrillary acidic protein, GAPDH glyceraldehyde phosphate dehydrogenase

Deng W., Fan C., Fang Y., Zhao Y., Wei Y., Li M, & Teng J. (2019). Role of XIAP gene overexpressed bone marrow mesenchymal stem cells in the treatment of cerebral injury in rats with cerebral palsy. Cancer Cell International, 19, 273.

+ Open protocol

+ Expand

RNA Extraction and qPCR Analysis Protocol for KGN Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

The TRIzol one-step method (Invitrogen; Thermo Fisher Scientific, Inc.) was used to extract total RNA from KGN cells. Total RNA concentration was detected using a nucleic acid protein analyzer (Beckman Coulter, Inc.). RT was immediately performed using the Prime Script RT-PCR kit (Takara Biotechnology Co., Ltd.) according to the manufacturer's instructions to avoid RNA degradation. qPCR analysis was performed using the quantitative SYBR-Green PCR kit (Qiagen GmbH) and the Mx4000 quantitative PCR system (Stratagene; Agilent Technologies, Inc.). The reaction conditions used for the qPCR were as follows: Initial denaturation for 5 min at 95˚C; followed by 40 cycles of denaturation at 95˚C for 10 sec, annealing at 60˚C for 30 sec and extension at 72˚C for 34 sec. The internal controls used were GAPDH or U6. Gene expression was analyzed using the 2^-ΔΔCq method (17 (link)). The primer sequences for PCR were listed as follows: GAPDH forward, 5'-CTTTGGTATCGTGGAAGGACTC-3' and reverse, 5'-GTAGAGGCAGGGATGATGTTCT-3'; U6 forward, 5'-GCTTCGGCAGCACATATACTAAAAT-3' and reverse, 5'-CGCTTCACGAATTTGCGTGTCAT-3'; miR-451a forward, 5'-ACACTCCAGCTGGGAAACCGTTACCATTAC-3' and reverse, 5'-CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGCTTACAG-3; ATF2 forward, 5'-TACAAGTGGTCGTCGG-3' and reverse, 5'-CGGTTACAGGGCAATC-3'; and cyclin D1 forward, 5'-CCGTCCATGCGGAAGATC-3 and reverse, 5'-GAAGACCTCCTCCTCGCACT-3'.

Yang T., Wang L., Zhang Y., Zheng J, & Liu L. (2021). MicroRNA-451a plays a role in polycystic ovary syndrome by regulating ovarian granulosa cell proliferation and apoptosis. Experimental and Therapeutic Medicine, 21(6), 583.

+ Open protocol

+ Expand

Relative Expression of circUbe3a, miR-138-5p, and RhoC

Check if the same lab product or an alternative is used in the 5 most similar protocols

The relative mRNA expression of circUbe3a, miR-138-5p, and RhoC was analyzed as previously described. Total RNA was extracted from cell lysates or SEVs using the TRIzol one-step method (Invitrogen, USA). The purity of the isolated RNA was determined by the optical density 260/280 ratio using a NanoDrop ND-2000 spectrophotometer (Thermo Scientific). The isolated RNA was reverse transcribed using a MiRNA qRT-PCR Starter Kit (RiboBio, China). RT-qPCR analyses were performed using SYBR Premix Ex Taq II (TaKaRa). RNase R treatment was used for circRNA detection as previously described. Stem-loop RT-qPCR TaqMan MicroRNA assays (Life Technologies) were used to determine the miRNA amounts. GAPDH or U6 was used as the internal reference. All the primer sequences are listed in Table 1. Gene expression was quantified using the 2^-∆∆Ct method.

Wang Y., Li C., Zhao R., Qiu Z., Shen C., Wang Z., Liu W., Zhang W., Ge J, & Shi B. (2021). CircUbe3a from M2 macrophage-derived small extracellular vesicles mediates myocardial fibrosis after acute myocardial infarction. Theranostics, 11(13), 6315-6333.

+ Open protocol

+ Expand

Quantifying Osteogenic and Inflammatory Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

The total cellular RNA was extracted using the TRIzol one‐step method (Invitrogen Life Technologies) and reverse‐transcribed to cDNA using a cDNA Synthesis kit (TaKaRa Bio, Inc, Otsu, Shiga, Japan). Primers were synthesized commercially (Shengong Co. Ltd) and were shown as follows: GAPDH, 5′‐ GACCTGACCTGCCGTCTA ‐3′ and 5′‐AGGAGTGGGTGTCGCTGT‐3′; OCN, 5′‐ CTCACACTCCTCGCCCTATT ‐3′ and 5′ ‐GCCTGGGTCTCTTCACTACCT ‐3′; OPN, 5′‐ ACTGATTTTCCCACGGACCT ‐3′ and 5′‐ CATTCAACTCCTCGCTTTCC ‐3′; RUNX2, 5′‐ CCATAACCGTCTTCACAAATCC ‐3′ and 5′‐ GCGGGACACCTACTCTCATACT ‐3′; VEGF, 5′‐ AGGGCAGAATCATCACGAAGT ‐3′ and 5′‐ AGGGTCTCGATTGGATGGCA ‐3′; TNF‐α, 5′‐ CCCGACTATCTCGACTTTGC ‐3′ and 5′‐ GGTTGAGGGTGTCTGAAGGA ‐3′; BMP‐2, 5′‐ CAGAAACGAGTGGGAAAACAAC ‐3′ and 5′‐ ATTCGGTGATGGAAACTGCTAT ‐3′; NF‐κB, 5′‐ CGACTATCTCGAGACCTTT ‐3′ and 5′‐ GCCTGGGCTCTCGTCTTCAC ‐3′; IL‐6, 5′‐ GCACCTCA ATTGTTGTTG ‐3′ and 5′‐ AAATAGTGTCCTAACGCTCA ‐3′; AMPK‐α, 5′‐ TCCCTATCTCGTCGAC ‐3′ and 5′‐ CGACCTGCTCGTGGCC ‐3′;. The genes expression was evaluated using a real‐time PCR kit (TaKaRa Bio). GAPDH was used as the housekeeping gene. The 2^−∆∆CT method was used to quantify the folded expression level. All tests were repeated in triplicate.

Xu L., Sun X., Zhu G., Mao J., Baban B, & Qin X. (2020). Local delivery of simvastatin maintains tooth anchorage during mechanical tooth moving via anti‐inflammation property and AMPK/MAPK/NF‐kB inhibition. Journal of Cellular and Molecular Medicine, 25(1), 333-344.

+ Open protocol

+ Expand

RNA Isolation and qPCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was isolated using the TRIzol one-step method (Invitrogen). RNA (1 μg) was used, and complementary DNA (cDNA) was obtained by reverse transcription with a PrimeScript RT reagent kit according to the manufacturer’s instructions (Takara Biotechnology, Dalian, China). qPCR was performed on a 7500 Real-Time PCR system (Applied Biosystems, Foster City, CA, USA) using SYBR Premix Ex Taq II kits (Takara Biotechnology) according to the manufacturer’s instructions. The U6 RNA level was used as the internal control for miRNAs. Relative expression was calculated using the comparative threshold cycle (2^−ΔΔCt) method.

Shen X., Jiang H., Chen Z., Lu B., Zhu Y., Mao J., Chai K, & Chen W. (2019). MicroRNA-145 Inhibits Cell Migration and Invasion in Colorectal Cancer by Targeting TWIST. OncoTargets and therapy, 12, 10799-10809.

+ Open protocol

+ Expand

Quantitative Real-Time PCR Protocol for Gene Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA of cells were extracted using Trizol one-step method (Invitrogen, Carlsbad, CA, USA) and the ultraviolet analysis and formaldehyde denaturing gel electrophoresis were applied to identify the high-quality RNA. After that, l μg RNA was collected and reverse-transcribed into cDNA by avian myeloblastosis virus reverse transcriptase. qPCR was conducted using a SYBR Green assay, and the PCR primers were designed and synthesized by Shanghai Sangon Biotech Co., Ltd (Shanghai, China) (Table I), with U6 or β-actin was set as the internal reference. The PCR reaction system was consisted of 1.0 μL cDNA, 10 μL 2× SYBR Green Mix, 0.5 μL Forward primer (10 μM), 0.5 μL reverse primer (10 μM) and RNase free water until the solution arrived at 20 μL. The PCR reaction condition was as follows: pre-denaturation at 94°C for 5 min, followed by 40 cycles of denaturation at 94°C for 40 s, annealing at 60°C for 40 s, extension at 72°C for 1 min, and a final extension at 72°C for 10 min. The production was identified using agarose gel electrophoresis. Data was analyzed using 2 -ΔΔCt method in which 2 -ΔΔCt refers to the ratio of the target gene expression between the experimental and control groups, the formula was as follows: ΔΔCt = [Ct (target gene) -Ct (internal control gene)] experimental group -[Ct (target gene) -Ct (internal control gene)] control group .

Tian H., Hou L., Xiong Y., & Cheng Q. (2020). Dexmedetomidine mediates microRNA-185 to suppress ovarian cancer growth via inhibiting the SOX9/Wnt/β-catenin signaling pathway.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!