Genez orf database

Manufactured by GenScript

The GenEZ™ ORF database is a comprehensive collection of open reading frame (ORF) sequences from various organisms. It is designed to provide researchers with a reliable and extensive resource for gene expression and functional studies.

Automatically generated - may contain errors

Lab products found in correlation

Pmd2 g, by Addgene (2 mentions) Pspax, by Addgene (2 mentions) Pgfp c shlenti, by OriGene (1 mentions) Pgfp c shlenti vector, by OriGene (1 mentions) Hek293ft, by Thermo Fisher Scientific (1 mentions) Puromycin, by Thermo Fisher Scientific (1 mentions)

2 protocols using genez orf database

Lentiviral Transduction of ErbB and PDGFRα Genes

Check if the same lab product or an alternative is used in the 5 most similar protocols

Human ErbB1, ErbB2, ErbB4 and PDGFRα were ordered from GenEZ™ ORF database (Genscript). Lentiviral vectors were generated by cloning ErbB1, ErbB2, ErbB4 and PDGFRα in pCDH-EF1-MCS (System Biosciences). Lentiviral particles were generated by PEI transfection of HEK293FT (Invitrogen) with pCDH, pMD2.G (addgene), psPAX (addgene) and purified on a sucrose cushion. ARPE-19 and MRC-9 were transduced at 60% confluency and expression was accessed after two days. Down regulations of ErbB1, ErbB2 and PDGFRα were done by lentiviral transduction of cells using 4 unique 29mer shRNA constructs in pGFP-C-shLenti and 29-mer scrambled shRNA cassette in pGFP-C-shLenti Vector (Origene) using manufacturer’s instructions. Best constructs were selected by puromycin selection and effective down regulation of the target gene without decrease in cell viability. Sequence of the shRNAs used are listed thereafter.

ErbB1: 5′_ATGGAGGAAGACGGCGTCCGCAAGTGTAA_3′,

ErbB2: 5′_TGTTGGATGATTGACTCTGAATGTCGGCC_3′

ErbB4: 5′_TGTAAGGCAATGCTGCCTACTATCAAACT_3′

PDGFRα: 5′–AGTTCCACCTTCATCAAGAGAGAGGACGA_3′

Scrambled: 5′_GCACTACCAGAGCTAACTCAGATAGTACT_3′

Kabanova A., Marcandalli J., Zhou T., Bianchi S., Baxa U., Tsybovsky Y., Lilleri D., Silacci-Fregni C., Foglierini M., Fernandez-Rodriguez B.M., Druz A., Zhang B., Geiger R., Pagani M., Sallusto F., Kwong P.D., Corti D., Lanzavecchia A, & Perez L. (2016). Platelet-derived growth factor-α receptor is the cellular receptor for human cytomegalovirus gHgLgO trimer. Nature microbiology, 1(8), 16082.

+ Open protocol

+ Expand

Gene Overexpression and Knockout

Check if the same lab product or an alternative is used in the 5 most similar protocols

Gene overexpression and KO for these studies were the same as in our previous work carried out to identify HCMV receptors (5 (link)). Human Nrp2 (accession no. AF022860), CD46 (accession no. NM_002389), and THBD (accession no. AF495471) were ordered from GenEZ ORF database (GenScript) and cloned in pCDH-EF1-MCS (System Biosciences). Lentiviral particles were generated by polyethylenimine transfection of 293FT (Thermo Fisher Scientific) with pCDH-EF1-MCS (System Biosciences), pMD2.G (Addgene), and psPAX (Addgene) and purified on a sucrose cushion. HAP-1 KO by CRISPR-Cas9 of NRP2 was generated by Horizon Genomics GmbH. HAP-1 cells transduced with lentivirus were selected for 3 days with puromycin (0.5 mg/ml; Thermo Fisher Scientific). Single clones were expanded, and effective KO of the target gene was analyzed by flow cytometry and confirmed by Sanger sequencing. Sequence of the guide RNAs used for CRISPR-Cas9 of Nrp2 is listed thereafter. Nrp2: 5′_GGGTAGTCCTGGGGGTAACC_3′.

Kschonsak M., Johnson M.C., Schelling R., Green E.M., Rougé L., Ho H., Patel N., Kilic C., Kraft E., Arthur C.P., Rohou A.L., Comps-Agrar L., Martinez-Martin N., Perez L., Payandeh J, & Ciferri C. (2022). Structural basis for HCMV Pentamer receptor recognition and antibody neutralization. Science Advances, 8(10), eabm2536.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!