7500 fast real pcr system

Manufactured by Thermo Fisher Scientific

The 7500 Fast Real-Time PCR System is a laboratory instrument designed for quantitative real-time polymerase chain reaction (qRT-PCR) analysis. It features fast thermal cycling and supports a wide range of fluorescent dye chemistries and detection channels to enable rapid and precise gene expression analysis and target detection.

Automatically generated - may contain errors

Lab products found in correlation

Sds 2, by Thermo Fisher Scientific (3 mentions) Taqman genotyping master mix 1x, by Thermo Fisher Scientific (2 mentions) Human custom taqman genotyping assay 40x, by Thermo Fisher Scientific (2 mentions) High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (1 mentions)

Close spelling variants of this product

7500 Fast Real-Time PCR System (4300 citations) ABI Prism 7500 Fast Real-Time PCR system (200 citations) 7500 system (124 citations) 7500 Fast (121 citations) 7500 Fast system (119 citations) 7500 PCR system (66 citations) 7500 Fast PCR system (42 citations) 7500 Fast Dx Real-Time PCR System (30 citations) Applied Biosystems 7500/7500 Fast Real-Time PCR System (14 citations) 7500 fast real-time RT-PCR system (11 citations)

4 protocols using 7500 fast real pcr system

Quantifying UCP1 and UCP3 Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA was extracted from samples of subcutaneous adipose tissue by using the phenol-chloroform extraction method modified by Chomczynski & Sacchi (1987)[17 (link)]. The DNA complementary (cDNA) was synthesized in a 50-mL reaction vessel containing 100 ng of total RNA. A high-Capacity cDNA Reverse Transcription^® kit (Life Technologies) was employed according to the manufacturer's instructions.
Gene expression was analyzed in triplicate by qPCR conducted on the 7500 Fast Real PCR System (Applied Biosystems). Relative quantification of both UCP1 and UCP3, toward the pooled sample, was calculated by using the comparative delta-delta-Ct method[18 (link)]. GAPDH and β-actin are the most stable reference genes for adipose tissue[19 (link)]. Therefore, during the assay, these compounds were used for normalization, to correct sample variations in RT-PCR efficiency and errors in quantification. The MIQE guidelines were followed[20 (link)].

Oliveira B.A., Pinhel M.A., Nicoletti C.F., Oliveira C.C., Quinhoneiro D.C., Noronha N.Y., Marchini J.S., Marchry A.J., Junior W.S, & Nonino C.B. (2016). UCP1 and UCP3 Expression Is Associated with Lipid and Carbohydrate Oxidation and Body Composition. PLoS ONE, 11(3), e0150811.

+ Open protocol

+ Expand

BDNF Genotyping by TaqMan Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols

DNA was extracted from peripheral blood leucocytes by a standardized salting-out procedure.25 (link) Genotyping of the Val⁶⁶Met polymorphism (rs6265) of the BDNF gene was determined using the forward (GGCTTGACATCATTGGCTGAC) and reverse (GGTCCTCATCCAACAGCTCTT) primers and probes in the Human Custom TaqMan Genotyping Assay 40x (Applied Biosystems, Foster City, CA, USA). One allele probe was labeled with VIC dye and the other was labeled with FAM dye. The reactions were conducted in a 96-well plate with a total reaction volume of 20 µl, using 2 ng of genomic DNA, TaqMan Genotyping Master Mix 1x (Applied Biosystems), and a custom TaqMan genotyping assay 1x. The plates were then positioned in a real-time PCR thermal cycler (7500 Fast Real PCR System; Applied Biosystems) and heated for 10 min at 95 °C, followed by 45 cycles of 95 °C for 15 s and 60 °C for 1 min. Fluorescence data files from each plate were analyzed using automated allele-calling software (SDS 2.1; Applied Biosystems).

Peters R.B., Xavier J., Mondin T.C., Cardoso T.D., Ferreira F.B., Teixeira L., Gräeff K., Quevedo L.D., Jansen K., Souza L.D., Oses J.P., Pinheiro R.T., da Silva R.A, & Ghisleni G. (2020). BDNF Val66Met polymorphism and resilience in major depressive disorder: the impact of cognitive psychotherapy. Brazilian Journal of Psychiatry, 43(1), 22-28.

+ Open protocol

+ Expand

DNA Extraction and Genotyping Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

Ten milliliters of blood were withdrawn (8:00-11:00 a.m.) by venipuncture after the interview. Blood samples were centrifuged (3500 g, at room temperature) for the separation of the leukocytes enriched fraction, and the DNA extraction was performed using a standardized salting-out procedure (Lahiri and Nurnberger, 1991 (link)). CD300f rs2034310 (C/T) single nucleotide polymorphism (SNP) has a minor allele frequency of 0.1725 in the European population (http://www.ncbi.nlm.nih.gov/projects/SNP/). Genotyping was performed using forward and reverse primers and probes contained in the 40× Human Custom TaqMan Genotyping Assay (Life Technologies, Foster City, CA, USA). The reactions were carried out using 2 ng of genomic DNA from each subject, TaqMan Genotyping Master Mix 1× (Applied Biosystems), and Custom TaqMan Genotyping Assay 1× in a real-time PCR thermal cycler (7500 Fast Real PCR System; Applied Biosystems), as previously described (Lago-Kaufmann et al., 2020 (link)). Fluorescence data files were analyzed using automated allele-calling software (SDS 2.0.1; Applied Biosystems).

Kaufmann F.N., Lago N., Alí-Ruiz D., Jansen K., Souza L.D., Silva R.A., Lara D.R., Ghisleni G., Peluffo H, & Kaster M.P. (2020). Sex-dependent role of CD300f immune receptor in generalized anxiety disorder. Brain, Behavior, & Immunity - Health, 11, 100191.

+ Open protocol

+ Expand

DIO2 Gene Genotyping in Peripheral Blood

Check if the same lab product or an alternative is used in the 5 most similar protocols

DNA was extracted from peripheral blood leukocytes by a standardized procedure. Primers and probes contained in the Human Custom TaqMan Genotyping Assay 40x (Applied Biosystems, Foster City, CA, USA) were used for genotyping our samples. The predesigned TaqMan SNP Genotyping Assay^® C_15819951_10 was used to analyze the DIO2 gene (rs225014 [Thr92Ala]) SNP (Applied Biosystems, Foster City, CA, USA). One allelic probe was labeled with VIC dye and the other with FAM dye. The reactions were conducted in a 96-well plate with a total 5 µL reaction volume using 2 ng of genomic DNA, TaqMan Genotyping Master Mix 1x (Applied Biosystems, Waltham, MA, USA), and Custom TaqMan Genotyping Assay 1x. The plates were then positioned in a real-time PCR thermal cycler (7500 Fast Real PCR System; Applied Biosystems) and heated for 10 min at 95 °C, followed by 50 cycles of 95 °C for 15 s and 60 °C for 90 s. Fluorescence data files from each plate were analyzed using automated allele-calling software (SDS 2.1; Applied Biosystems).
Patients were classified as Ala/Ala, Thr/Ala, or Thr/Thr genotypes. All amplification reactions were performed twice. The genotyping success was over 95%, with a calculated error rate based on PCR duplicates of 0%.

Schwengber W.K., Silveira V.B., Hetzel G.M., Robaina A., Ceolin L., Camelier M.T., Goemann I., Dalla Corte R.R., Scheffel R.S., de Mello R.G., Maia A.L, & Dora J.M. (2022). Type 2 Deiodinase Thr92Ala Polymorphism Is Not Associated with Cognitive Impairment in Older Adults: A Cross-Sectional Study. Metabolites, 12(5), 375.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!