DNA extraction from cells was performed using the DNA extraction kit (Machery-Nagel) according to the manufacturer’s instruction. The bisulfite reaction was done with the EpiTect Bisulfite kit (Qiagen) according to the manufacturer’s instruction. A PCR was done in a highly enriched region of the Notch3 promoter and further sequenced. The sequences were analyzed using the FinchTV Software to visualize the nucleotide peaks. The methylated cytosine residues were determined following sequence alignment.
Dna extraction kit
Manufactured by Macherey-Nagel
Sourced in Germany, France
The DNA extraction kit is a laboratory product designed to isolate and purify DNA from various biological samples. It contains the necessary reagents and materials to efficiently extract DNA while maintaining its integrity.
Automatically generated - may contain errors
Lab products found in correlation
Epitect bisulfite kit, by Qiagen (1 mentions)
Plasmid midi kit, by Thermo Fisher Scientific (1 mentions)
Hiseq 2500, by Illumina (1 mentions)
Nextera xt dna sample preparation kit, by Illumina (1 mentions)
Oligo donor dna, by Shanghai Model Organisms (1 mentions)
Ab23345, by Abcam (1 mentions)
Protein a bead, by Thermo Fisher Scientific (1 mentions)
11 protocols using dna extraction kit
1
Notch3 Promoter Methylation Analysis
2
Genetic Variation in IL-1 Family Cytokines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Twenty-one SNPs in the IL-1 family (IL-1α, IL-1β, and IL-1RA) genes of proinflammatory cytokines were selected based on database searches (http://ncbi.nlm.nih.gov/SNP ) for this study. The IL-1 family of genes are located on chromosome 2q14. The 21 SNPs were selected in the IL-1 family genes based on heterozygosity (above 0.1). The selected SNPs of the IL-1 family genes were located on chromosome 2q14, which included IL-1α and IL-1β (2 in the exon region, 1 in the 5′near gene, and 6 in the intron region).
Peripheral blood samples were collected from each subject and then stored at −20°C. The genomic DNAs of subjects were extracted from the peripheral blood samples with a commercial DNA extraction kit (Macherey Nagel, Germany). Genotyping of all SNPs was carried out using Golden-Gate SNP Genotyping Assay.
Peripheral blood samples were collected from each subject and then stored at −20°C. The genomic DNAs of subjects were extracted from the peripheral blood samples with a commercial DNA extraction kit (Macherey Nagel, Germany). Genotyping of all SNPs was carried out using Golden-Gate SNP Genotyping Assay.
3
Mitochondrial DNA Quantification Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DNA was extracted using a DNA extraction kit (Macherey–Nagel EURL, France). 2 ng of the total DNA were used for qPCR analysis, and the mitochondrial DNA content was calculated from the ratio of the DNA of the NADH dehydrogenase subunit 1 gene (mitochondrial gene) to that of lipoprotein lipase gene (a nuclear gene) as previously described [44] (link).
4
Genome Sequencing of Bacterial Isolates
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA was purified from strain 48-IT using a DNA extraction kit (Macherey Nagel). Plasmid DNA from 48-IT was purified using a Plasmid Midi Kit (Invitrogen). Genomic and plasmid DNA were used to prepare two different shotgun libraries, which were sequenced on the 454-GS platform following the standard sequencing procedure (Roche Diagnostics). Reads obtained were assembled using the GS-FLX gsAssembler software (Roche Diagnostics).
WGS of CIV4-IT, KH-43-CO and KL-49-CO was performed on DNA extracted using the Macherey Nagel kit. Genomic DNA paired-end libraries were generated using the Nextera XT DNA sample preparation kit (Illumina) and sequenced using a MiSeq instrument with 2×300 PE protocol (Illumina).
DNA from UK isolates was extracted with the Qiasymphony DSP (Qiagen). DNA libraries were prepared using the Nextera XT sample preparation method and sequenced with a standard 2×100 PE protocol on a HiSeq 2500 instrument (Illumina). De novo assembly of Illumina reads was performed using the Galaxy version 20150522 of A5 pipeline through the ARIES public Galaxy server (https://w3.iss.it/site/aries/ ) [21 (link)].
WGS of CIV4-IT, KH-43-CO and KL-49-CO was performed on DNA extracted using the Macherey Nagel kit. Genomic DNA paired-end libraries were generated using the Nextera XT DNA sample preparation kit (Illumina) and sequenced using a MiSeq instrument with 2×300 PE protocol (Illumina).
DNA from UK isolates was extracted with the Qiasymphony DSP (Qiagen). DNA libraries were prepared using the Nextera XT sample preparation method and sequenced with a standard 2×100 PE protocol on a HiSeq 2500 instrument (Illumina). De novo assembly of Illumina reads was performed using the Galaxy version 20150522 of A5 pipeline through the ARIES public Galaxy server (
5
Genomic DNA Extraction and PCR Amplification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA was extracted from 20 mL of cultures of Tnea, Trq7 and Tmar after 24 h of growth, using a DNA extraction kit (Macherey-nagel, Oensingen, Switzerland) and following the manufacturer’s instructions. For amplification of V-ATPase and F-ATPase, primers were designed on catalytic subunits coded by CTN_RS04540 and CTN_RS04145 (Supplementary Table S3 ). PCR was performed using the following conditions: 5 min at 95 °C, 45 s at 95 °C, 30 s at 60 °C, 72 °C 2 min, 72 °C 10 min, 40 cycles.
6
Molecular Screening of EEHV in Elephants
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DNA was extracted from elephant blood samples using a DNA extraction kit (Machery-Nagel GmbH, Dauren, Germany), according to the manufacturer’s instructions. Specific primers, namely, pan-polymerase and terminase-specific primers, were used in PCR analysis for the screening of EEHV, as previously described [2 (link),18 (link),19 (link)]. Briefly, samples were screened for EEHV using PAN-EEHV POL primers 6710/6711 [10 (link)]. Then, the positive samples were confirmed for the EEHV subtype using terminase-specific primers for EEHV1 [2 (link)] and terminase-specific primers for EEHV3/4, as previously described [6 (link)] (Supplementary Table S1 ). The specific EEHV subtypes were further determined by sequencing, as has also been described previously [18 (link),19 (link)].
7
Quantification of Mitochondrial DNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA was extracted from cell culture using a DNA extraction kit (Macherey–Nagel EURL, France). 2 ng of the total DNA were used for qPCR analysis, and data evaluation was performed as described previously [39] (link), [57] (link). The mitochondrial DNA copy number was calculated from the ratio of the DNA of the NADH dehydrogenase gene, a mitochondrial gene, to that of lipoprotein lipase gene, a single copy nuclear gene. The oligonucleotide sequences, designed using Primer Express software, are shown in Supplementary Table 1 .
8
Generating TPCN2 R210C Mouse Model
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The CRISPR/Cas9 technology was used to introduce the Tpcn2 R194C variant, homologous to the human TPCN2 R210C variant, into the C57BL/6J mice. In brief, Cas9 mRNA and gRNA (5′-AGAAGACCCTGAAGTGTATACGG-3′) were obtained by in vitro transcription, and synthesized oligo donor DNA was obtained from Shanghai Model Organisms Center, Inc. The gRNA targeted mouse Tpcn2 exon 6, where the oligo donor DNA would introduce the substitution into the mouse genome. Fertilized eggs were collected from C57BL/6J females. Cas9 mRNA, gRNA, and oligo donor DNA were microinjected into the fertilized eggs. All mice studies were approved by the Institutional Animal Care and Use Committee of Institute of Genetics and Developmental Biology, Chinese Academy of Sciences. Genotyping was performed in all generations of mice by PCR followed by Sanger sequencing. DNA was extracted from mouse tails with a DNA extraction kit according to the manufacturer’s instructions (Macherey-Nagel, Germany). PCR amplification was performed with the forward primer: 5′-ATGAGCACAGCCTAGGAGGA −3′, and the reversed primer: 5′-AGCTGAGAGAAGCAAGGTTGA −3′.
9
Whole-Genome Sequencing of Bacterial Isolates
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The Illumina MiSeq instrument (Illumina Inc., San Diego, CA, USA) was used to obtain Whole-Genome Sequencing (WGS) of the four strains isolated from respiratory tract samples of patients 1, 6, 7 and 8, named 0831, 1009, 1021 and 1027, respectively. Bacteria were grown overnight at 37°C on LB agar with ampicillin (50 mg/mL). Genomic DNA was purified following the MachereyNagel DNA extraction kit procedures (Düren, Germany) directly from the LB plate.
The strains 0831 and 1027 were also subjected to Oxford Nanopore Technologies sequencing. To obtain high molecular weight DNA, the bacterial pellet of 7 mL LB liquid incubated overnight was resuspended in TE with 2% SDS and 20 μL of 25 mg/ml proteinase K. Protein digestion was performed for 1h at 55°C followed by phenol (pH 8.0) extraction and isopropanol precipitation. After washing with 70% Et-OH, DNA was resuspended overnight in TE at +4°C and purified using AMPure XP beads in a 0.5/1 ratio. Libraries were prepared by the rapid barcoding sequencing kit (SQK-RBK004). Pooled libraries were cleaned up using AMPure XP beads and loaded into the MinION Flow Cell (R9.4.1) following SQK-RBK004 sequencing procedures. Sequencing was performed on an Mk1C MinION platform.
The strains 0831 and 1027 were also subjected to Oxford Nanopore Technologies sequencing. To obtain high molecular weight DNA, the bacterial pellet of 7 mL LB liquid incubated overnight was resuspended in TE with 2% SDS and 20 μL of 25 mg/ml proteinase K. Protein digestion was performed for 1h at 55°C followed by phenol (pH 8.0) extraction and isopropanol precipitation. After washing with 70% Et-OH, DNA was resuspended overnight in TE at +4°C and purified using AMPure XP beads in a 0.5/1 ratio. Libraries were prepared by the rapid barcoding sequencing kit (SQK-RBK004). Pooled libraries were cleaned up using AMPure XP beads and loaded into the MinION Flow Cell (R9.4.1) following SQK-RBK004 sequencing procedures. Sequencing was performed on an Mk1C MinION platform.
10
Eomes-Mediated Th17 Gene Regulation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Th17 cell lines overexpressing Eomes were fixed with 1% formaldehyde, followed by 0.125 M glycine incubation. Cells were subsequently lysed with SDS Lysis Buffer to release chromatin, which was then sheared by sonication. Anti-Eomes (ab23345, Abcam) was added overnight at 4 °C. Unspecific IgG was used as negative control. DNA-protein antibody complexes were immunoprecipitated via protein A beads (Thermo Fisher). Cross-linking was reversed by incubation at 65 °C for 4 h. ChIP DNA as well as input DNA was purified with DNA extraction kit (Macherey Nagel). Finally, real-time qPCR was performed to detect the abundance of RORC2, IL17A and IL2 genes by using the following primers: RORC2-F GGAGTCCCAGCAAGATCAGA; RORC2-R TTCAGGGCC CCTCAGTATTC; IL17A-F GTGTCACCCCTGAACCCAC; IL17A-R GAGATGGACAAAATGTAGCGCT; IL2-F CCTCAACTCCTGCCA-CAATG; IL2-R CAGTAAATGCTCCAGTTGTAGCT. Genomic location of amplicon products is reported in Supporting Information Fig. 5.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!