Co2 controller

Isolated NE oocytes were microinjected in TM with IBMX using inverted microscope Leica DMI 6000B, TransferMan NK2 (Eppendorf) and FemtoJet (Eppendorf). Solution used for oocyte injection contained: 20 ng/µL of in vitro transcribed H2b:gfp RNA (mMessage, Ambion) from plasmid (provided by Dr. Martin Anger, Laboratory of Cell Division Control, IAPG CAS) in combination with 1 mM morpholinos (control: CCTCTTACCTCAGTTACAATTTATA and Ank2.3: TGTGACTGCCTGTCTACCATCAAAC; Gene Tools) - to block translation of Ank2.3 mRNA. 1.5 h after microinjection oocytes were washed from IBMX and cultivated to MII stage. Microinjected oocytes were placed into 4-well culture chamber (Sarstedt) in 10 µL of equilibrated M16 media (37.5 °C, 5% CO₂) covered with mineral oil (M8410; Sigma Aldrich). The cells were imaged using inverted microscope Leica DMI 6000B equipped with a controlled chamber system (Tempcontroller 2000–2 Pecon, and a CO₂ controller, Pecon). Time lapse movies (LAS X, Leica microsystems) of meiotic maturation of microinjected oocytes with chromatin marker (H2b:gfp) and morpholinos were used for phenotype evaluation (nuclear envelope breakdown, polar body extrusion).

Oocytes were scanned with an inverted wide field microscope, Leica DMI 6000B (Leica Microsystems, Wetzlar, Germany), equipped with a chamber system (Pecon, Erbach, Germany), a Tempcontroller 2000-2 (Pecon), and a CO₂ controller (Pecon). Cover-glass-based 4-well chambers (94.6190.402, Sarstedt, Nümbrecht, Germany) were used for live oocytes imaging. Oocytes were put into a 10 µL drop of M16 medium without IBMX and covered by approximately 1 mL of mineral oil (M8410, Sigma-Aldrich). The chamber was pre-tempered to 37 °C and 5% CO₂. Images were captured every 5 min. Timing of the NEBD and polar body extrusion (PBE) were evaluated through time lapse movies.