Bca protein assay reagent

HEK293T cells were transfected with shRNA vector and packaging plasmid mix using Neofect DNA transfection reagents (Tengyi Biotech, #TF201201). The supernatant containing virus was collected 48 h after transfection with a 0.45-μm filter. Targeted cells were infected with shRNA lentivirus with 8 µg/mL polybrene (Sigma, #H9268) and then selected with 2 µg/mL of puromycin (Sangon Biotech, #A610593-0025) for one week. The shRNA primers are as follows:
sh#1 F:CCGGCTGAAGTTCTGGAGTTCCCAACTCGAGTTGGGAACTCCAGAACTTCAGTTTTTG;
sh#1 R:AATTCAAAAACTGAAGTTCTGGAGTTCCCAACTCGAGTTGGGAACTCCAGAACTTCAG
sh#2 F:CCGGGAAGAGATAGAGCATGACATACTCGAGTATGTCATGCTCTATCTCTTCTTTTTG;
sh#2 R:AATTCAAAAAGAAGAGATAGAGCATGACATACTCGAGTATGTCATGCTCTATCTCTTC
The efficiency of silencing was assessed by immunoblotting. For immunoblotting analysis, cells were lysed in modified RIPA buffer (50 mM Tris-HCl, pH 7.4, 1% Nonidet P-40, 0.25% sodium deoxycholate, 150 mM NaCl, and 1 mM EDTA). Protein concentrations were determined using BCA protein assay reagent (Yeasen, #20201ES90). Cell extracts were subjected to SDS-PAGE, transferred to PVDF membranes (Millipore, #IPVH00010), and incubated with the indicated primary antibodies (RIMKLB: Proteintech, 26111-1-AP; vinculin:Sigma, V9131).

Modified RIPA buffer (50 mM Tris–HCl, pH7.4, 1% Nonidet P-40, 0.25% sodium deoxycholate, 150 mM NaCl, and 1 mM EDTA) supplemented with protease inhibitors and phosphatase inhibitors (Bimake, Houston, USA) was utilized to lyse cells. Protein concentrations were detected by BCA protein assay reagent (Yeasen, Shanghai, China). Cellular extracts were resolved through SDS-PAGE, transferred to PVDF membranes (Millipore, Billerica, USA), then incubated with the indicated primary antibodies. Enhanced chemiluminescent substrate kit (Yeasen) was used to analyze corresponding antibody specific signals. Table S4 lists the antibodies used.