mRNA was extracted with the RNeasy Mini Kit (Qiagen, 74104). 500 ng of each sample were used to generate cDNA by reverse transcription using the SuperScript™ IV VILO™ Master Mix (Invitrogen, 11756050). 2 μl of the cDNA were used to detect the presence of Sendai virus transcripts using GoTaq Green Polymerase (Promega, M7123), and the oligos as recommended in the CytoTune iPS 2.0 kit (Invitrogen, A16517). Gapdh was amplified as loading control using oligos with the following sequence: Z25-132:GAPDH_F1_GHB: TGGTGAAGGTCGGAGTGAAC and Z25-133:GAPDH_R1_GHB: GAAGGGGTCA TTGATGGCGA). The PCR products were analyzed on a 2% agarose gel containing ethidium bromide.
Cytotune ips 2.0 kit
Manufactured by Thermo Fisher Scientific
The CytoTune iPS 2.0 kit is a tool used for the reprogramming of somatic cells into induced pluripotent stem cells (iPSCs). The kit contains a set of non-integrating Sendai virus vectors that express the Yamanaka factors (Oct3/4, Sox2, Klf4, and c-Myc) necessary for the induction of pluripotency.
Automatically generated - may contain errors
2 protocols using cytotune ips 2.0 kit
1
Sendai Virus Transcript Detection
2
Sendai Virus Transcript Detection
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!