Hifair 3 1st strand cdna synthesis supermix for qpcr

Manufactured by Takara Bio

The Hifair® III 1st Strand cDNA Synthesis SuperMix for qPCR is a ready-to-use solution for the reverse transcription of RNA into complementary DNA (cDNA) for use in quantitative real-time PCR (qPCR) applications.

Automatically generated - may contain errors

Lab products found in correlation

Lightcycler 480 sybr green 1 master supermix, by CWBIO (2 mentions) Trizol reagent, by Thermo Fisher Scientific (2 mentions)

Close spelling variants of this product

Hifair III 1st Strand cDNA Synthesis SuperMix CDNA Synthesis SuperMix

2 protocols using hifair 3 1st strand cdna synthesis supermix for qpcr

qRT-PCR for Gene Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Cells were collected, total RNA was prepared using Trizol Reagent (Invitrogen) according to the manufacturer’s instructions. First-strand complementary DNA was synthesized from equal amounts of total RNA (4 μg) using Hifair^® III 1st Strand cDNA Synthesis SuperMix for qPCR (11141ES10, TAKARA) and analyzed by Lightcycler 480 SYBR green I master supermix (CW0659S, CWBIO) incorporation in PCR reactions involving specific primers (Table 1) and performed in a real-time qPCR system (Rotor-Gene3000). The expression level was also calculated using the 2^–ΔΔCt method.Table 1

qRT-PCR primer sequence

Primer name	Sequence 5′ → 3′
EPB41L1	F: AGGAAACCACGCCGAGACACAA
EPB41L1	R: GGTGGATGAGTTTGCTGTTGGG
GAPDH	F: GGAGCGAGATCCCTCCAAAAT
GAPDH	R: GGCTGTTGTCATACTTCTCATGG

Liang T., Sang S., Shao Q., Chen C., Deng Z., Wang T, & Kang Q. (2020). Abnormal expression and prognostic significance of EPB41L1 in kidney renal clear cell carcinoma based on data mining. Cancer Cell International, 20, 356.

+ Open protocol

+ Expand

Quantitative Real-Time PCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Cells were collected, and total RNA was prepared using Trizol Reagent (Invitrogen) according to the manufacturer’s instructions. First-strand complementary DNA was synthesized from equal amounts of total RNA (4 μg) using Hifair^® III 1st Strand cDNA Synthesis SuperMix for qPCR (11141ES10, TAKARA) and analyzed by Lightcycler 480 SYBR green I master supermix (CW0659S, CWBIO) incorporation in PCRs involving specific primers (Table 1) and performed in a real-time qPCR system (Rotor-Gene3000). The expression level was also calculated using the 2^–Δ^Δ^Ct method.

Liang T.T., Shao Q., Deng Z.C., Wang T, & Kang Q.Z. (2020). Systemic Expression Analysis Reveals Prognostic Significance of WIPI3 in Hepatocellular Carcinoma. Frontiers in Genetics, 11, 847.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!