Zymo dna clean and concentrator 25 kit

Phage supernatants were concentrated by centrifugation. The phage pellet was resuspended in SM buffer (100 mM NaCl, 8 mM MgSO₄·7 H₂O, 50 mM Tris-Cl (pH 7.5)) and incubated sequentially with lysozyme (50 mg mL⁻¹), TURBO DNase and TURBO DNase buffer (ThermoFisher Scientific, Waltham, MA, USA), and proteinase K (20 mg mL⁻¹). Then, 5 M NaCl and 10% CTAB/0.7 M NaCl solution were added, and samples were transferred to phase lock gel tubes (light PLG tubes, QuantaBio, Beverly, MA, USA) with an equal amount of phenol:chloroform:isoamyl alcohol (25:24:1 v/v, pH = 8.0, ThermoFisher Scientific, Waltham, MA, USA) and centrifuged. The top aqueous DNA-containing layer was left to precipitate overnight at −80 °C in 100% ice-cold ethanol and samples were then purified with the Zymo DNA Clean and Concentrator 25 kit (Zymo Research, Irvine, CA, USA). DNA concentrations were quantified with the Qubit dsDNA high-sensitivity (HS) assay kit (ThermoFisher Scientific, Waltham, MA, USA).

Quantification of late reverse transcription products was previously described in [22 (link),66 (link)]. In short, cells were harvested 19 hours post-infection and unintegrated cDNA was collected using the Qiagen mini-prep kit (QIAprep Spin Miniprep Kit, # 27106). Samples were concentrated using the Zymo DNA Clean and Concentrator-25 kit (Zymo, D4033). HIV cDNA was amplified with TaqMan gene expression master mix (Applied Biosystems, 4369016), J1 FWD (late RT F)—ACAAGCTAGTACCAGTTGAGCCAGATAAG, J2 REV (late RT R) GCCGTG CGCGCTTCAGCAAGC, and LRT-P (late RT probe)—6-carboxyfluorescein (FAM)-CAGTGGCGCCCGAACAG GGA-6-carboxytetramethylrhodamine (TAMRA) [67 (link),68 (link)]. Data were acquired on an ABI QuantStudio5 real-time (qPCR) machine and analyzed on Prism software.