T24 cells were plated in 6-well plates at a concentration of 6x104 cells/well, and incubated overnight. Incubation and transfection of siRNA using DharmaFECT 1 reagent (GE Life Sciences, Dharmacon) was performed as per the manufactures protocol. Specifically, for each well, 2.5μL of 5μM siRNA and 1.37μL of DharmaFECT 1 reagent (GE Life Sciences Dharmacon) were used. The siRNA used were previously published: siHOTAIR (siRNA-1 UAACAAGACCAGAGAGCUGUU ; siRNA-2 CCACAUGAACGCCCAGAGAUU ); and control siGFP (CUACAACAGCCACAACGUCdTdT .) was obtained from GE Life Sciences Dharmacon [51 (link)].
Dharmafect 1 reagent
Manufactured by GE Healthcare
Sourced in United States
DharmaFECT 1 reagent is a cationic lipid-based transfection reagent used for the delivery of small interfering RNA (siRNA) and other nucleic acids into a variety of mammalian cell types. It is designed to efficiently transfect cells and facilitate the uptake of nucleic acids.
Automatically generated - may contain errors
Lab products found in correlation
Fetal bovine serum (fbs), by Thermo Fisher Scientific (2 mentions)
Srb assay, by Merck Group (1 mentions)
Non targeting sirna, by RiboBio (1 mentions)
Pcmv6 empty plasmid, by OriGene (1 mentions)
Lipofectamine 3000 transfection reagent, by Thermo Fisher Scientific (1 mentions)
Dmem medium, by Thermo Fisher Scientific (1 mentions)
Sv huc 1, by American Type Culture Collection (1 mentions)
Sirna, by GE Healthcare (1 mentions)
On targetplus smartpool, by GE Healthcare (1 mentions)
Opti mem, by Thermo Fisher Scientific (1 mentions)
Attractene, by Qiagen (1 mentions)
Control sirna, by Horizon Discovery (1 mentions)
Rpmi 1640, by Thermo Fisher Scientific (1 mentions)
Rnaseout, by Thermo Fisher Scientific (1 mentions)
Isogen, by Nippon Gene (1 mentions)
Dharmafect 1 reagent, by Thermo Fisher Scientific (1 mentions)
Opti mem medium, by Thermo Fisher Scientific (1 mentions)
Penicillin, by Thermo Fisher Scientific (1 mentions)
Streptomycin, by Thermo Fisher Scientific (1 mentions)
Smooth muscle cell growth supplement, by Thermo Fisher Scientific (1 mentions)
12 protocols using dharmafect 1 reagent
1
Knockdown of lncRNA HOTAIR in T24 Cells
2
SOX2 Knockdown Impacts Chemotherapy
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To determine the effect of SOX2 down-regulation on chemotherapy response, cell lines were transfected with SOX2 siRNA SMARTpool (GE Healthcare, Cat. Nr: L-011778-00-0005) using reverse transfection with DharmaFECT reagent 1 (GE Healthcare, Cat. Nr: T-2001-02). Concentrations of siRNA and transfection reagent for both cell lines were determined based on the manufacturer’s recommendation for OVCAR3 cells. Growth inhibition following treatment was assessed in a 96-well format. The cells were treated with a range of carboplatin or paclitaxel doses (Selleckchem, Cat. Nr: S1215 & S1150) and proliferation was assessed after 7 days using the SRB assay (Sigma Aldrich, Cat. Nr: S1402). Confirmation of SOX2 knock-down on the protein level was performed by Western blotting, as described earlier.
3
Silencing Mouse and Human LincRNA-p21 with siRNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
siRNA targeting mouse p53 (5′-AGAAGAAAAUUUCCGCAAAdTdT-3′), mouse LincRNA-p21 #1 (5′- UGAAAAGAGCCGUGAGCUAdTdT-3′),26 (link) mouse LincRNA-p21 #2 (5′- AAATAAAGATGGTGGAATGdTdT-3′), human LincRNA-p21 (5′- CUGCAAGGCCGCAUGAUGAdTdT-3′) and the negative control (GFP, 5′-GGCUACGUCCAGGAGCGCACCdTdT-3′) were synthesized by Life Technologies and transfected at the final concentration of 100 nM. All transfections were performed using DharmaFECT Reagent 1 (GE Healthcare, Little Chalfont, UK) according to the manufacturer's recommendations. Cells were exposed to UVB 48 h post siRNA transfection.
4
Modulating LASS2 Expression in Bladder Cancer Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cancerous J82, T24, 5637, BIU-87 cell lines and normal uroepithelial SV-HUC-1, were obtained from American Type Culture Collection. Cells were cultured in DMEM medium (Gibco, USA) containing 10% FBS (Invitrogen, USA) at 37℃ in 5% CO2.
LASS2 siRNA and non-targeting siRNA were purchased from RiboBio (Guangzhou, China). The LASS2 siRNA sequence was 5'-AACCATCGTAAGAATGACTGA-3'. LASS2 siRNA2 sequence is 5'-TGCGCTATAGGGTCACTTTAA-3'. LASS2 siRNA was transfected using DharmaFECT 1 Reagent (GE healthcare, CO, USA) according to the protocol. pCMV6-LASS2 plasmid and pCMV6 empty plasmid were obtained from Origene (Origene, Rockville, USA). Lipofectamine 3000 transfection reagent was used for plasmid transfection (Invitrogen, USA).
LASS2 siRNA and non-targeting siRNA were purchased from RiboBio (Guangzhou, China). The LASS2 siRNA sequence was 5'-AACCATCGTAAGAATGACTGA-3'. LASS2 siRNA2 sequence is 5'-TGCGCTATAGGGTCACTTTAA-3'. LASS2 siRNA was transfected using DharmaFECT 1 Reagent (GE healthcare, CO, USA) according to the protocol. pCMV6-LASS2 plasmid and pCMV6 empty plasmid were obtained from Origene (Origene, Rockville, USA). Lipofectamine 3000 transfection reagent was used for plasmid transfection (Invitrogen, USA).
5
Knockdown of FAK1 in Cell Survival
6
siRNA Knockdown of WWC3 Gene
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
siGENOME siRNA pool for WWC3 (M-013869-01-0005) and negative control siRNA (D-001206-13-05) were obtained from Dharmacon (GE Healthcare, Lafayette, CO, USA). siRNAs were transfected by using DharmaFECT 1 reagent (GE Healthcare) according to the manufacturer’s protocol. Cells were harvested for assessment after 48 h.
7
LINC00152 Knockdown Using siPOOLs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For LINC00152 knockdown using siPOOLs32 (link), cells were reverse transfected with 30 nM (final concentration) of siControl or siLINC00152 (siTOOLs Biotech) using 2 μl DharmaFECT1 reagent (GE Healthcare) in 6-well plates. Cells were lysed in 1 ml TRI reagent for RNA extraction or 1x RIPA buffer for protein extraction 60 hours post transfection. siPOOL sequences are listed in Supplementary Table S4 .
8
MCT4 Silencing in Cell Lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Transfections of siRNA duplexes targeting MCT4 or a nontargeting control (NT) (ON-TARGETplus SMARTpool, GE Healthcare) at a final concentration of 25 nM, were performed in Optimem (Invitrogen), using Dharmafect 1 reagent (GE Healthcare).
9
TRIM22 Regulates NSCLC Cell Lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
NSCLC cell lines H460, A549, H358, LK2, H1299, H3255 and normal bronchial epithelial cell line NHBE were obtained from ATCC. The cell lines were cultured with RPMI-1640 (Gibco, USA) containing 10 percent bovine serum at 37°C with 5%CO2.
pCMV6-empty vector and pCMV6-TRIM22 plasmid were obtained from Origene company (Origene, Rockville, MD, USA). Plasmid transfection was performed using Attractene (Qiagen, Hilden, Germany) according to manufacturer’s instructions. TRIM22 siRNA, β-catenin siRNA and control siRNA were obtained from Dharmacon (GE healthcare, USA). siRNA transfection was performed using Dharmafect1 reagent (GE healthcare, USA).
pCMV6-empty vector and pCMV6-TRIM22 plasmid were obtained from Origene company (Origene, Rockville, MD, USA). Plasmid transfection was performed using Attractene (Qiagen, Hilden, Germany) according to manufacturer’s instructions. TRIM22 siRNA, β-catenin siRNA and control siRNA were obtained from Dharmacon (GE healthcare, USA). siRNA transfection was performed using Dharmafect1 reagent (GE healthcare, USA).
10
miR-S1-3p RNA Pulldown Assay
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
BxPC-3 and HDF cells (4 × 105 cells/1 mL/well) were seeded into 12-well microplates (4 × 105 cells/1 mL/well) and preincubated overnight at 37 °C. The next day, cells were transfected with 5′-byotinylated single-strand RNA encoding miR-S1-3p or scrambled control (synthesized by Fasmac, Kanagawa, Japan) using the Dharmafect 1 reagent (GE Healthcare, Piscataway, NJ, USA). After 24 h, cells were lysed with avidin-pull-down lysis buffer (20 mM Tris-HCl pH 7.4, 100 mM KCl, 5 mM MgCl2, 0.5% NP-40, and 0.5 mM DTT) supplemented with RNaseOUT (Invitrogen) and pulled down with streptavidin-conjugated DynabeadsTM magnetic beads (Invitrogen) for 1 h at 22–27 °C. RNAs from the resultant precipitate were isolated with ISOGEN (Nippon Gene, Osaka, Japan) and dis-solved with 15 µL of RNase-free H2O.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!