Similarly to the above assays, neutrophils were incubated with the different bacteria for 3 hrs (verses un-exposed naïve controls) and centrifuged at 1200RPM at RT for 20min. The supernatants were collected and stored for protein-based analysis and the pellets were eluted in Trisol (Invitrogen) for RT-PCR analysis. All samples were stored at -800 C until analysis.
Trisol
Manufactured by Thermo Fisher Scientific
Sourced in United States
Trisol is a reagent used for the isolation and purification of total RNA from various biological samples. It is a monophasic solution containing phenol and guanidine isothiocyanate, which facilitates the lysis of cells and the subsequent separation of RNA from DNA and proteins.
Automatically generated - may contain errors
Lab products found in correlation
Superscript 2 plus rnase h reverse transcriptase, by Thermo Fisher Scientific (2 mentions)
Rna clean kit, by Qiagen (2 mentions)
Hiseq 1500, by Illumina (1 mentions)
Nebnext mrna library perp reagent set, by New England Biolabs (1 mentions)
Rna 6000 nano kit, by Agilent Technologies (1 mentions)
Bioanalyser, by Agilent Technologies (1 mentions)
Ssoadvanced universal sybr green supermix, by Bio-Rad (1 mentions)
Goscript reverse transcription system, by Promega (1 mentions)
Transcriptome analysis console software, by Thermo Fisher Scientific (1 mentions)
Genechip human transcriptome array 2, by Thermo Fisher Scientific (1 mentions)
Anti mmp 9, by Santa Cruz Biotechnology (1 mentions)
Anti nf κb p65, by Abcam (1 mentions)
Enhanced chemi luminescence (ecl), by Kodak (1 mentions)
7 protocols using trisol
1
Neutrophil-Bacteria Interaction Assay
2
RNA Sequencing of Cell Cultures
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Three replications for each sample and each cell culture (2 patients × 2 conditions × 2 cultures × 3 replicates = 24 total) were used for isolation and sequencing. RNA was isolated using Trisol (Invitrogen, Waltham, MA, USA) in accordance to manufacturer’s recommendations.
Quality and quantity of isolated RNA was evaluated using «BioAnalyser» tool and RNA 6000 Nano Kit (Agilent, Santa Clara, CA, USA). Poly(A) fraction was extracted from total RNA for sequencing. Libraries for sequencing were prepared from poly(A) fraction using NEBNext® mRNA Library Perp Reagent Set (NEB, Rowley, MA, USA). Sequencing was performed using HiSeq1500 (Illumina, San Diego, CA, USA), obtaining no less than 10 mln. 50 bp reads per library.
Quality and quantity of isolated RNA was evaluated using «BioAnalyser» tool and RNA 6000 Nano Kit (Agilent, Santa Clara, CA, USA). Poly(A) fraction was extracted from total RNA for sequencing. Libraries for sequencing were prepared from poly(A) fraction using NEBNext® mRNA Library Perp Reagent Set (NEB, Rowley, MA, USA). Sequencing was performed using HiSeq1500 (Illumina, San Diego, CA, USA), obtaining no less than 10 mln. 50 bp reads per library.
3
mRNA Isolation and qRT-PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The mRNAs from cells were isolated using Trisol (Invitrogen). One microgram of total mRNA was reverse transcribed using GoScript Reverse Transcription System (Promega). Real-time PCR was performed using SSO Advanced Universal SYBR Green Supermix (Bio-Rad). Specific primers for BAX (forward: CATGTTTTCTGACGGCCAACTTC; reverse: AGGGCCTTGAGCACCAGTTT, PMM1 (forward: GACAGCTTGACACCATCCA; reverse: CGGCAAAGATCTCAAAGTCGTT) and RPL29 (forward: GGCTATCAAGGCCCTCGTAAA; reverse: CGAGCTTGCGGCTGACA) were purchased from Sigma-Aldrich.
4
Prophage Gene Expression in M. avium Biofilm
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To determine the expression of prophage genes upon biofilm formation, bacterial RNAs were obtained at 24h, days 3 and 5, after M. avium was placed in contact with a polyvinyl chloride plate surface. The Real-Time (RT) PCR was carried out using the conditions as previously described [17 (link)]. Briefly, total bacterial RNAs from broth grown bacteria (control) and from biofilms (experimental) were extracted with the combination of a guanidine thiocyanate-based buffer (Trisol) (Invitrogen, Carlsbad, CA) and rapid mechanical cell lysis of M.avium in a bead-beater. Prior to the real-time PCR, RNA was cleaned up with RNA clean kit (QIAGEN, Valencia, CA) and treated with DNase I. RNA quality was verified by ethidium bromide staining on the agarose gel and by OD260/280 nm absorption. Mycobacterial total RNA (1 μg) was reverse transcribed with 100U of Superscript II Plus RNase H− Reverse Transcriptase (Invitrogen, Carlsbad, CA), using RT primers according to the manufacturer’s instruction. M. avium gene expressions were quantified with SYBR Green I assay by Real-Time PCR detection system using gene-specific primers.
5
RNA Extraction and Transcriptome Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was extracted from the HuCCT1 cell line using Trisol (Invitrogen) and submitted to Biolancet Technology, Ltd. (Beijing, China). Gene expression microarray was performed using the Affymetrix GeneChip Human Transcriptome Array 2.0 and analyzed using Affymetrix Transcriptome Analysis Console software. The heatmap was drawn using R software.
6
Evaluating NF-κB and MMP-9 expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
After 48 hours, cell lines transfected with miR-625-
5p and backbone vector were cultured and rinsed three
times with cold PBS solution.
Total protein was extracted from cells by trisol
(Invitrogen, Carlsbad, CA, USA) and cell lysis buffer
(Biyuntian Biotechnological Co., USA). The protein
concentration of the lysate was calculated from the
standard line of BSA.
First 5 µl protein was boiled at 95°C for 5 minutes
and then cooled on ice. Then it was run on an SDS-PAGE gel (Millipore, USA) to determine its quality
and electrotransferred to PVDF membrane (Life
Science, Amersham, Braunschweig, Germany).
Membranes were blocked by non-fat dry milk (w/v)
and then immunoblotted with anti-NF-κB-p65
(Abcam, Inc., Cambridge, MA, USA) and anti-MMP-9 (Santa Cruz Biotechnology. Inc, USA) at 4°C
overnight (dilutions 1: 200 and 1: 700, respectively),
followed by horseradish peroxidase-conjugated rabbit
(Abcam, Inc., Cambridge, MA, USA) and goat (Santa
Cruz Biotechnology. Inc, USA) secondary antibodies
(dilution1:3000) incubated at room temperature for
one hour. NF-κB and MMP-9 protein bands were
visualized with ECL (Kodak Image Station; New
Haven, CT, USA). The band densities were analyzed
to use Image J software (n=3) (18 (link)).
5p and backbone vector were cultured and rinsed three
times with cold PBS solution.
Total protein was extracted from cells by trisol
(Invitrogen, Carlsbad, CA, USA) and cell lysis buffer
(Biyuntian Biotechnological Co., USA). The protein
concentration of the lysate was calculated from the
standard line of BSA.
First 5 µl protein was boiled at 95°C for 5 minutes
and then cooled on ice. Then it was run on an SDS-PAGE gel (Millipore, USA) to determine its quality
and electrotransferred to PVDF membrane (Life
Science, Amersham, Braunschweig, Germany).
Membranes were blocked by non-fat dry milk (w/v)
and then immunoblotted with anti-NF-κB-p65
(Abcam, Inc., Cambridge, MA, USA) and anti-MMP-9 (Santa Cruz Biotechnology. Inc, USA) at 4°C
overnight (dilutions 1: 200 and 1: 700, respectively),
followed by horseradish peroxidase-conjugated rabbit
(Abcam, Inc., Cambridge, MA, USA) and goat (Santa
Cruz Biotechnology. Inc, USA) secondary antibodies
(dilution1:3000) incubated at room temperature for
one hour. NF-κB and MMP-9 protein bands were
visualized with ECL (Kodak Image Station; New
Haven, CT, USA). The band densities were analyzed
to use Image J software (n=3) (18 (link)).
7
Prophage Gene Expression in M. avium Biofilm
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!