Abi 7500 rt pcr machine

Cell samples were extracted using TRIzol reagent and total RNA was extracted through the chloroform-isopropanol precipitation method. The total RNA was converted into cDNA using a RevertAidTM First Stand cDNA Synthesis Kit. The mRNA of the samples was detected through quantitative real-time polymerase chain reaction (RT-PCR) using SYBR Green I via an ABI 7500 RT-PCR machine (Applied Biosystems, USA). Three parallel samples were set for each sample, and each replicate was tested in three independent replicates. Quantitatively detected genes contained the internal control gene (ACTB), pluripotency marker genes (OCT-4, NANOG), osteogenic differentiation-related genes (RUNX2, ALP, COL1A1, OCN) and telomerase reverse transcriptase (TERT) gene. The primer sequences of these genes are shown in Table S1.

Total RNA from PP and small intestine samples was extracted with QIAzol reagent and isolated using an RNeasy Mini Kit (QIAGEN, Hilden, Germany) according to the manufacturer’s instructions. cDNA was synthesized using a PrimeScript RT Reagent Kit (TaKaRa) according to the manufacturer’s instructions. Quantitative real-time RT-PCR was performed using SYBR Premix Ex Taq (TaKaRa) in an ABI 7500 RT-PCR machine (Applied Biosystems). Real-time PCR analyses were run at 95 °C for 30 s and then for 40 cycles of 95 °C for 3 s and 60 °C 30 s. Expression levels were normalized to the housekeeping gene GAPDH, which was used as an internal control. The sequences of the primers were as follows: IL-6, 5’-TGGAGTCACAGAAGGAGTGGCTAAG-3’ and 5’-TCTGACCACAGTGAGGAATGTCAAC-3’; IL-10, 5’-CCAAGCCTTATCGGAAATGA-3’ and 5’-TTTTCACAGGGGAGAAATCG-3’; IL-12p40, 5’- TGGTTTGCCATCGTTTTGCTG -3’ and 5’- ACAGGTGAGGTTCACTGTTTCT -3’; IL-21, 5’-CGCCTCCTGATTAGACTTCG-3’ and 5’-TGTTTCTTTCCTCCCCTCCT-3’; IFN-γ, 5’-ACTGGCAAAAGGATGGTGAC-3’ and 5’-TGAGCTCATTGAATGCTTGG-3’; STAT3, 5’-GACCCGCCAACAAATTAAGA-3’ and 5’-TCGTGGTAAACTGGACACCA-3’; STAT4, 5’-CATCCCTGAAAACCCTCTGA-3’ and 5’-GACATGGGGAGAAGGTCTGA-3’; Bcl-6, 5’-CCTGAGGGAAGGCAATATCA-3’ and 5’-CGGCTGTTCAGGAACTCTTC-3’; pIgR, 5’-GCTCCAAAGTGCTGTTCTCC-3’ and 5’-TTGCTGTGTGTCTGGAGAGG-3’; and GAPDH, 5’-TGTGTCCGTCGTGGATCTGA-3’ and 5’-TTGCTGTTGAAGTCGCAGGAG-3’.

Whole spleen, PVAT, and the ileum were respectively homogenized in TRIzol reagent (Catalog No. 00571510, Thermo Fisher Scientific, Waltham, MA, USA), and total RNA was extracted using a RiboPure Kit (Catalog No. AM1924, Life Technologies, Carlsbad, CA, USA), according to the manufacturer's protocol. A total of 500 ng of RNA was reverse-transcribed to cDNA using a High Capacity RNA-to-cDNA Kit (Catalog No. 4387406, Applied Biosystems, Foster City, CA, USA), according to the manufacturer's protocol. The cDNAs were subsequently mixed with RT2 SYBR Green ROX qPCR Master mix (Catalog No. 1712516, Thermo Fisher Scientific), and RT-PCR was performed in accordance with the manufacturer's instructions. Thermal cycling and fluorescence detection were performed using an ABI7500 RT-PCR machine (Applied Biosystems), according to the manufacturer’s recommendations. The relative mRNA expression levels were determined using glyceraldehyde-3-phosphate dehydrogenase (Gapdh) as the housekeeping gene and the 2^−ΔΔCt method. The primers used for each gene are listed in S1 Table.