Reverse transcriptase

We adopted Trizol reagent (Invitrogen, Thermo Fisher Scientific) for extracting total brain tissue RNA, which was further prepared reverse transcribed to cDNA using reverse transcriptase ((TIANGEN, China) in line with specific protocols. Quantitative PCR was conducted with the use of a SYBR green kit (TIANGEN, China) and a PCR machine instrument (BioRad, Singapore). The sequences of the primers used are shown below: AQP4, forward (F): CTTTCTGGAAGGCAGTCTCAG, reverse (R): CCACACCGAGCAAAACAAAGAT; MMP9, F: CTGGACAGCCAGACACTAAAG, R:CTCGCGGCAAGTCTTCAGAG; ZO-1, F: GCCGCTAAGAGCACAGCAA, R: TCCCCACTCTGAAAATGAGGA; Occludin, F: TTGAAAGTCCACCTCCTTACAGA, R: CCGGATAAAAAGAGTACGCTGG; and GAPDH, F: AGGTCGGTGTGAACGGATTTG, R: TGTAGACCATGTAGTTGAGGTCA. Finally, the gene level was analyzed using the 2^–∆∆Ct approach.

Total RNA of leaves inoculated with Pcc and control subjects was extracted using the Polysaccharide and Polyphenol Plant Rapid RNA Isolation Kit (Tiangen Biotech, Beijing, China) according to the manufacturer’s protocol, then the DNA in total RNA was removed with DNase I (Tiangen Biotech, Beijing, China). The concentration and purity were checked using the NanoDrop2000 spectrophotometer. First-strand cDNA synthesis with reverse transcriptase (Tiangen Biotech, Beijing, China) according to the manufacturer’s protocol using 1 μg of RNA template. The expression analysis was conducted using FastKing One Step qRT-PCR Kit (SYBR) (Tiangen Biotech, Beijing, China) and software (v.2.4.1) (Applied Biosystems, Leuven, Belgium). The actin gene was used as a reference in all experiments. Primers used for qRT-PCR are listed in Table S4. All reactions were performed in triplicate, and fold change was calculated using the formula 2^−ΔΔCt. Finally, the data were analyzed via DPS v.9.01 (Institute of Computing Technology, Chinese Academy of Sciences, Beijing, China) and Microsoft Office Excel v.2019 (Microsoft, Redmond, MA, USA), and Duncan’s test was employed to compare significant differences between treatments, and all data were the mean ± standard error of three biological and three technical replicates.

RNA was extracted from various issues or 14-day-old seedlings after different treatments using TRIzol reagent (Invitrogen, Carlsbad, CA, USA) according to manufacturer’s instructions. Total RNA was digested to remove the genomic DNA and used for first-strand cDNA synthesis using reverse transcriptase (TIANGEN). qRT-PCR was performed using SYBR Premix Ex Taq (TaKaRa, Dalian, China) and CFX96TM Real-Time PCR Detection System (Bio-Rad, Hercules, CA, USA) to examine gene expression levels. The housekeeping gene Actin in N. tabacum was used as control. The expression levels were calculated using the 2^−ΔΔCt comparative CT method. Three biological replicates were performed.

Total RNA was extracted from the fourth leaf of the indicated leaf ages using Trizol reagent (Invitrogen). Reverse transcription was performed using reverse transcriptase (Tiangen). cDNA was diluted 1:10 and subjected to quantitative PCR using SuperReal PreMix Plus (Tiangen) and a 7500 Real Time PCR System (Applied Biosystems, United States) cycler according to the manufacturer’s manual. The level of ACT2 transcript was adopted as an internal control. The oligonucleotide primers for Real-time PCR are summarized in Supplementary Table 1.

In 2015, we repeated the above experiment by increasing the biological replicate from 5 to 20 per patch. Due to the larger sample size, we randomly selected five adult females and five adult males from each cage, with every treatment (patch) comprising four replicates, repeated three times for PCR detection. We ground the samples from each replicate for RNA extraction using RNAprep pure Tissue Kit (TIANGEN Biotech Co., Ltd., China), then reversed the RNA samples into cDNA using reverse transcriptase (TIANGEN Biotech Co., Ltd., China).

R)Total RNA was extracted using TRIzol reagent (Invitrogen Inc.,Carlsbad, CA, USA). The quality and quantity of extracted RNA were assessed using NanoDrop (Thermo Fisher Scientific, Waltham, MA, USA). Reverse transcriptase was used to produce the first-strand complementary DNA (TIANGEN, Beijing, China) according to the manufacturer’s instructions. miRNA Real-Time PCR Assay kit was used to detect miRNA expression levels (TransGen, Beijing, China). mRNA expression was normalized to GAPDH expression, whereas miRNA was normalized to U6 expression. The relative RNA expression was calculated using the delta/delta CT method. Specific primers are shown in Table S1.