Abi 3130 genetic analyser

The viral RNA was extracted from the viral isolates using a QIAamp Viral RNA Mini Kit (Qiagen, USA) according to the manufacturer’s instructions, and stored at −80 °C.Primer pairs 486 and 488 were used for amplifying the partial VP1 coding region28 (link). RT-PCR (reverse transcription–polymerase chain reaction) was performed using the PrimeScript One Step RT-PCR Kit Ver.2 (TaKaRa, Dalian, China) as previously described17 (link). Amplicons were purified using the QIAquick PCR purification kit (Qiagen, Germany) and sequenced using an ABI 3130 Genetic Analyser (Applied Biosystems, Hitachi, Japan). Every nucleotide position of each strand was sequenced at least once. The obtained VP1 sequences were compared with sequences available in the GenBank database for molecular typing using the EV Genotyping Tool29 (link).

Two long-distance PCR amplifications were performed using a PrimeScript^TM One Step RT-PCR Kit Ver.2 (TaKaRa, Dalian, China). The primers used for RT-PCR and sequencing of the full-length genome were designed by a “primer-walking” strategy^{38 (link)} and are listed in Table 3. The PCR products were purified using the QIAquick PCR purification kit (Qiagen, Germany), and sequenced in both directions at least two from each strand using ABI 3130 Genetic Analyser (Applied Biosystems, USA).Table 3

Primers used for complete genome amplification and sequencing.

primer	Sequence (5′-3′)	Nucleotide position*	Orientation
224	GCIATGYTIGGIACICAYRT	1977–1996	Forward
222	CICCIGGIGGIAYRWACAT	2969–2951	Reverse
E181F	TTAAAACAGCCTGTGGGTTG	1–20	Forward
E181R	TGTGCCATGAAGGGTGTA	2431–2414	Reverse
E181r	GGAACGCGGTGACTCATC	340–323	Reverse
E181f	CTATAAGGATGCGGCATC	839–856	Forward
E182F	CATAAACGTTAGGGAGA	2714–2730	Forward
E182f	GTACTTCTCGCAGCTGGG	3600–3617	Forward
E184f	CAGAGTGATCAAGAGCA	4263–4269	Forward
E185r	CCCAACTGGGATGTACAT	5749–5732	Reverse
E186r	CCTGGGTTTTGGTGAAAG	6520–6503	Reverse
E187f	GACAAGGGAGAGTGTTT	7018–7034	Forward
E188R	ACCGAATGCGGAGAATTTAC	7410–7391	Reverse

*Numbering according to the genome of E-18 strain E18-314/HB/CHN/2015.

The 3′ variable region of the cagA gene was amplified using the conditions described by Mendoza-Elizalde et al. [18 (link)]. The primers used were those described by Rudi et al. [64 (link)]. The PCR products were separated by electrophoresis on 1.5% agarose gels. The PCR products were purified using ExoSap IT® (Affymetrix, Cleveland, OH, USA) according to the manufacturer’s recommendations. The purified products were sequenced using a BigDye Terminator v3.1 Cycle Sequencing Kit in an ABI 3130 genetic analyser (Applied Biosystems, Foster City, CA, USA). The sequences obtained were aligned using the CAP3 Sequence Assembly program (available at: http://doua.prabi.fr/softwore/cap3). After alignment, the nucleotide sequences were translated into amino acid sequences using the Blastx program (available at http://blast.ncbi.nlm.nih.gov/Blast.cgi) and compared with sequences deposited in GenBank (http://www.ncbi.nlm.nih.gov/genbank/).

Genomic DNA was obtained from blood using the DNeasy Blood & Tissue Kit (QiaGen) according to the manufacturer’s instructions. BRCA1 and BRCA2 coding regions and their intron–exon boundaries were amplified using PCR primers complementary to flanking intron sequences. Primers were designed by primer 3 software [7 (link)] and then evaluated by single nucleotide polymorphism (SNP) check software [8 ] to test for the presence of SNPs in their length, especially at the 3′ end. Sequencing reactions were performed by using an ABI Prism Big Dye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems). Sequenced PCR products were purified using CentriSeptfiltration columns (Applied Biosystems) following the manufacturer’s instructions. Sequencing was carried out using an ABI 3130 genetic analyser (Applied Biosystems). Visual inspection of base calling was used to evaluate the quality of DNA sequencing. NCBI reference sequences (RefSeq) NM_007294.3 and NM_000059.3 were used for the annotation of BRCA1 and BRCA2 variants, respectively. These RefSeq transcripts are included in the Locus Reference Genomic (LRG) data LRG_292-BRCA1 and LRG_293-BRCA2. Bi-directional sequencing review was performed using Mutation Surveyor Software (v.5.0.0, Soft Genetics, State College, PA). BRCA1/2 variant data were submitted to the Clinical Variation Database (ClinVar) [9 (link)].

DNA extraction was performed following the protocol in Fischer et al. (2022) (link). We then genotyped P.destructans isolates using 18 microsatellite markers (Drees et al. 2017a (link)) and two mating type markers in four PCR multiplexes as described in Dool et al. (2018) (link), see also Fischer et al. (2022) (link). Genotyping was carried out using an ABI 3130 Genetic Analyser (Applied Biosystems) and the GeneMapper Software v.5 (Applied Biosystems).

The gold standard for the identification of a female as a haemophilia carrier was genetic testing. Inversion testing, DNA sequencing and the gene dosage assay were subsequently carried out until the detection of the pathogenic mutations. Long-distance PCR or inverse-shifting PCR according to the research of Rossetti et al. was utilized for inversion tests [12 ,13 (link)]. Sanger sequencing with ABI 3130 Genetic Analyser (Applied Biosystems, Waltham, MA, USA) or next-generation sequencing using MiSeqDx^® (Illumina Inc., San Diego, CA, USA) was performed for DNA sequencing. Multiple ligation-dependent probe amplification was applied for the gene dosage assay. As for females who had wanted to undergo carrier testing, we carried out targeted gene mutation analysis for the same pathogenic mutation as their own probands. We classified the pathogenic mutations into null (inversion, nonsense, and frameshift) and non-null mutations (missense and splicing).