Lightcycler faststart dna masterplus sybr green 1 kit

RNA extraction, complementary DNA synthesis, quantitative real-time PCR (Q-PCR) reactions were performed as previously described [30 (link)]. SERPINB3 and HIF-2α mRNA levels were measured by Q-PCR, using the SYBR® green method as described [30 (link)]. The amplification mix was prepared using Roche LightCycler FastStart DNA MasterPLUS SYBR Green I kit following manufacturer's instructions and real-time PCR was performed using LightCycler instrument. Oligonucleotide sequence of primers used for RT-PCR were: sense, 5′-GCAAATGCTCCAGAAGAAAG-3′, reverse 5′-CGAGGCAAAATGAAAAGATG-3′ (for human SERPINB3); sense, 5′-GGAGCCACGGTCTCTCAGTA-3′, reverse 5′-TGCATCTATGGGGATGAGAA-3′ (for human SERPINB4); sense, 5′-CGCTAGACTCCGAGAACAT-3′, reverse 5′-GGCTTGAACAGGGATTCAGT-3′ (for human HIF2α). Gliceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as internal reference and co-amplified with target samples using identical Q-PCR conditions. In particular, expression of SERPINB3 and HIF-2α mRNA was also assessed by Q-PCR in 67 frozen liver tumor samples displaying different patterns of SERPINB3 expression (SERPINB3 negative/low expression or SERPINB3 high expression) [30 (link)]. Samples were run in triplicate and mRNA expression was generated for each sample. Specificity of the amplified PCR products was determined by melting curve analysis and confirmed by agarose gel electrophoresis.

PCR analyses were determined through real-time quantitative PCR, on a LightCycler 2.0 instrument (Roche) using the LightCycler FastStart DNA MasterPLUS SYBR Green I kit (Roche) essentially as described in Terol et al. (2015) (link). Each individual PCR reaction contained 2 ng of genomic DNA extract from leaves using the DNeasy Plant Mini Kit (Qiagen) according to the manufacturer’s instructions. Cycling protocol consisted of 10 min at 95 °C for preincubation followed for 45 cycles of 10 s for denaturation, 10 s at 60 °C for annealing, and 20 s at 72 °C for extension. Specificity of the PCR reaction was assessed by the presence of a single peak in the dissociation curve after amplification and through size estimation of the amplified product. Specificity of PCR reaction was confirmed by direct Sanger sequencing of the PCR product. Primers used are listed in table 5.
Table 5.

Specific Primers for the Determination of Heteroplasmic Positions.

Name	Frame	SNP Position	Sequence
C21826-F1	+	21826	5′-GCATCTTGGACTAGCCATCG-3′
C21826-R1	−		5′-ACCGTGGGCCATATTTCTCT-3′
C20848-F2	+	20848	5′-CCCGAATCTCAGCAATCACT-3′
C20848-R2	−		5′-TAACCCTTCGAACACAAGCA-3′
C69792-F1	+	69792	5′-GTTGCCCACTCAATCTGTTG-3′
C69792-R2	−		5′-AATCTGCCTTGCCTAGGAATC-3′

RT-qPCR was performed with a LightCycler FastStart DNA MasterPlus SYBR Green I kit (Roche Diagnostics, Burgess Hill, United Kingdom) according to the manufacturer’s protocol on a LightCycler 480 (Roche Diagnostics). All primers used were exon–exon spanning and were tested both for efficiency using a standard curve and for specificity by melting curve analysis and gel electrophoresis of the PCR products (Table 4). All primers had an efficiency of 2.0 ± 0.2. The results were determined from plates where no-template controls were used, to ensure that the reagents were contamination free. Triplicate CTs were averaged, and the results were analyzed by the ΔΔCT method (28 (link)).

qPCR was performed on a LightCycler 2.0 instrument with the LightCycler FastStart DNA Master^PLUS SYBR Green I kit (Roche Diagnostics, Mannheim, Germany). The mRNA levels of the genes of interest were first normalized to HPRT (hypoxanthine-guanine-phosphoribosyltransferase, ΔCT value) and then to the respective control condition (ΔΔCT value). The ΔΔCT value was used for the determination of the relative expression. The following oligonucleotide primers were obtained from ThermoScientific (Ulm, Germany): adiponectin forw 5′-GGC CGT GAT GGC AGA GAT-3′, adiponectin rev 5′-CCTTCA GCC CCG GGT ACT-3′ CEBP/α forw 5′-GAC CCT CAGCCTTGT TTGTAC TGT ATG CC-3′, CEBP/α rev 5′- TTT GGAAAG CTT GTC ATA ACT CCG GTC CC-3′ CEBP/β forw 5′- CCG CCCGTG GTG TTA TTT AAA GAA GAAA C GTC-3′, CEBP/β rev 5′- GCC CGTAGG AAC ATC TTT AAG CGA TTA CTC AG-3′ CEBP/δ forw 5′- CCA TCGACT TCA GCGCCT ACA TCG ACT C- 3′, CEBP/δ rev 5′-CCC GCCTTG TGA TTG CTG TTG AAG AGG T-3′ Glut-4 forw 5′-TTC CAACAG ATA GGC TCC GAA G-3′, Glut-4 rev 5′-AAG CAC CGC AGA GAA CAC AG-3′ HPRT forw 5′-GAG ATG GGA GGC CAT CAC ATT GTA GCC CTC-3′, HPRT rev 5′-CTC CAC CAA TTA CTT TTA TGT CCC CTG TTG ACT GGT C-3′ PPARγ forw 5′-GAT CCA GTG GTT GCA GAT TAC AA-3′, PPARγ rev 5′-GAG GGA GTT GGA AGG CTC TTC-3′ SREBP1C forw 5′-TTT CTGACA CGC TTC TTC CTG AGC AGT G-3′, SREBP1C rev 5′-ATG TTCCCG GAATAG CTG AGT CAC CTG G-3′.

Total RNA was isolated from UC-MSCs using TRIzol Reagent (Invitrogen, USA). Quantitative real-time (qRT)-PCR was performed using a LightCycler FastStart DNA MasterPLUS SYBR Green I kit (Roche). GAPDH was used as an endogenous control. The primers (Table 1) specific to target genes were synthesized by TSINGKE Biological Technology (Beijing, China). Template cDNA was added to the reaction mixture, and amplification was initiated with a 10 min template denaturation step at 95 °C, followed by 40 cycles of 95 °C for 15 s and 60 °C for 1 min. All samples were amplified in triplicate.
Table 1

Primers used in this study

Gene	Forward (5′-3′)	Reverse (5′-3′)
GAPDH	GGAGCGAGATCCCTCCAAAAT	GGCTGTTGTCATACTTCTCATGG
IDO	TGCCAACTCTCCAAGAAAC	GCAGTCTCCATCACGAAAT
HGF	GCTATCGGGGTAAAGACCTACA	CGTAGCGTACCTCTGGATTGC
VEGF	CTGGGCTGTTCTCGCTT	CCCCTCTCCTCTTCCTTCT
TGF-β	CTAATGGTGGAAACCCACAACG	TATCGCCAGGAATTGTTGCTG
IL-6	CCTGAACCTTCCAAAGATGGC	TTCACCAGGCAAGTCTCCTCA
IL-10	GACTTTAAGGGTTACCTGGGTTG	TCACATGCGCCTTGATGTCTG

Validity testing of IL-8 gene expression was conducted by quantitative (Q)-PCR. Total RNA was isolated and reverse transcribed using a Taqman Reverse Transcriptase Reagent Kit (Roche) and primed with random hexamers. Primer sequences were selected using National Center for Biotechnology Information Primer-BLAST. Real-time PCR (Q-PCR) was performed using a LightCycler FastStart DNA Master^PLUS SYBR Green I Kit (Roche). Primer sequences were as follows: IL-8 forward: 5′-CTTGGCAGCCTTCCTGA-3′ and IL-8 reverse: 5′- TTCTTTAGCACTCCTTGGCAAAA-3′; and CXCR1 forward: 5′-TGGGGACTGTCTATGAATCTGT-3′ and CXCR1 reverse: 5′-GCAACACCATCCGCCATTTT-3′. Samples were quantified at the log-linear portion of the curve using LightCycler analysis software and compared with an external calibration standard curve.