For inhibition of CXCR3, Clathrin, and LRP1 expression, cells were transiently transfected with annealed siRNA. CXCR3, Clathrin, and LRP1-specific siRNAs were used (ON-TARGETplus Human CXCR3 (ref: 2833), ON-TARGETplus Human Clathrin heavy chain (smart pool of 4 siRNA, L-004001-01-0005), and ON-TARGETplus Human LRP1 (ref: 4035) with siRNA number 7 named siLRP1-3, GE Healthcare Europe GmbH, Dharmacon). A siRNA-random (siRNA CTRL, SR-CL000-005) used as a negative control. Two others siRNAs against human LRP1 were synthesized by Eurogentec (Angers, France). The LRP1-specific sense and antisense RNA oligonucleotides were as follows: siLRP1-1/sense siRNA, GCAGUUUGCCUGCAGAGAUtt, and antisense siRNA, AUCUCUGCAGGCAAACUGCtt and siLRP1-2/sense SiRNA AUGCUGACCCCGCCGUUGCtt and antisense siRNA GCAACGGCGGGGUCAGCAUtt. Transfection was performed using lipofectamine RNAimax Kit (Fisher 10601435) in accordance with the manufacturer’s protocol, with siRNA at a final concentration of 20 nM in media without antibiotics. After transfection, cells were washed with PBS and fresh complete media was added for 48 h.
Lipofectamine rnaimax kit
Manufactured by Thermo Fisher Scientific
Sourced in United States
The Lipofectamine RNAiMAX kit is a transfection reagent designed for efficient delivery of small interfering RNA (siRNA) and other nucleic acids into a variety of cell types. The kit provides a simple and effective method for gene silencing experiments.
Automatically generated - may contain errors
Lab products found in correlation
Fetal bovine serum (fbs), by Thermo Fisher Scientific (7 mentions)
Mir nc, by RiboBio (4 mentions)
Lipofectamine 3000 kit, by Thermo Fisher Scientific (3 mentions)
Opti mem, by Thermo Fisher Scientific (3 mentions)
Dual luciferase reporter assay system, by Promega (3 mentions)
Lipofectamine 3000 transfection kit, by Thermo Fisher Scientific (3 mentions)
Penter vector, by Charles River Laboratories (3 mentions)
Pcdna nc, by RiboBio (3 mentions)
Rpmi 1640 medium, by Thermo Fisher Scientific (3 mentions)
Lipofectamine 3000 reagent, by Thermo Fisher Scientific (2 mentions)
Nc sirna, by GenePharma (2 mentions)
Penicillin and streptomycin, by Thermo Fisher Scientific (2 mentions)
Lipofectamine 2000 kit, by Thermo Fisher Scientific (2 mentions)
Dulbecco modified eagle medium (dmem), by Thermo Fisher Scientific (2 mentions)
Dual luciferase reporter assay system psicheck 2 vector, by Promega (2 mentions)
Hec 1a, by Procell (2 mentions)
Sirnas, by Thermo Fisher Scientific (1 mentions)
Silencer select, by Thermo Fisher Scientific (1 mentions)
On targetplus non targeting pool d 001810 10, by Horizon Discovery (1 mentions)
Mc11714, by Thermo Fisher Scientific (1 mentions)
71 protocols using lipofectamine rnaimax kit
1
Targeted Silencing of Cell Surface Receptors
2
Transient Smad3 Silencing in Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For transient inhibition of Smad3 expression, cells were transfected with annealed siRNA. Transfections were performed using lipofectamine RNAimax kit (Fisher 10601435) in accordance with the manufacturer protocol, with a final concentration of 20 nM in media without antibiotics. After transfection, cells were washed twice with PBS and fresh complete media was added for 48 h.
3
Silencing CXCR3 Expression in Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For inhibition of CXCR3 expression, cells were transiently transfected with annealed siRNA. CXCR3 specific siRNAs were used (ON-TARGETplus Human CXCR3 (2833). A siRNA-random (siRNA CTRL, SR-CL000-005) was used as a negative control. Transfection was performed using lipofectamine RNAimax kit (Fisher 10601435) in accordance with the manufacturer’s protocol, with siRNA at a final concentration of 20 nM in media without antibiotics for 6 hours at 37 °C. After transfection, cells were washed with PBS and fresh complete media was added for 48 h.
4
Generating Stable HEK293 Cell Lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Stable HEK293 cell lines were generated using the Flp-In T-REx core kit as described (Schäffler et al. 2010 (link)). Stable cell lines were grown in DMEM containing 10% FCS, 10 µg/mL blasticidine, and 100 µg/mL hygromycin B. Flp-In T-REx 293 cells were cultivated in DMEM containing 10% FCS, 10 µg/mL blasticidine, and 100 µg/mL Zeocin and HEK293 cells in DMEM containing 10% FCS and 1% Pen/Strep.
For transfection of plasmid DNA the Nanofectin kit (GE Healthcare) was used. siRNAs targeting LARP4B and LARP4 were purchased from Thermo Fisher Scientific. siRNAs against LARP1 [GAAUGGAGAUGAGGAUUGC(dTdT)], firefly luciferase [CGUACGCGGAAUACUUCGA(dTdT)], and GFP [GCAAGCUGACCCUGAAGUUC(dTdT)] were synthesized by Eurofins MWG Operon. siRNA was transfected using the Lipofectamine RNAi Max kit (Life Technologies).
For preparation of cell extracts, cells were washed with PBS and harvested using lysis buffer. After incubation for 10 min on ice the extracts were centrifuged (10 min, 9000g, 4°C) to remove cell debris and the supernatant was used in downstream applications.
For transfection of plasmid DNA the Nanofectin kit (GE Healthcare) was used. siRNAs targeting LARP4B and LARP4 were purchased from Thermo Fisher Scientific. siRNAs against LARP1 [GAAUGGAGAUGAGGAUUGC(dTdT)], firefly luciferase [CGUACGCGGAAUACUUCGA(dTdT)], and GFP [GCAAGCUGACCCUGAAGUUC(dTdT)] were synthesized by Eurofins MWG Operon. siRNA was transfected using the Lipofectamine RNAi Max kit (Life Technologies).
For preparation of cell extracts, cells were washed with PBS and harvested using lysis buffer. After incubation for 10 min on ice the extracts were centrifuged (10 min, 9000g, 4°C) to remove cell debris and the supernatant was used in downstream applications.
5
Silencing Innate Immune Receptors by siRNA Transfection
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
SC grown to 60–70% confluency in a medium without penicillin–streptomycin were then transfected with 30 pmol of small interfering RNAs (siRNAs) using the Lipofectamine RNAiMax kit (Life Technologies). In brief, the siRNA-Lipofectamine RNAiMAX complexes (siRNA in 50 μl of Opti-MEM medium mixed with 3 μl of Lipofectamine RNAiMAX) were added to each well and mixed gently. After 24 h of incubation, half of the media was removed and replenished with fresh media. The silencing efficiency was quantified by RT-PCR and/or Western blotting at 48 hpt. The different pools of siRNAs (Silencer Select, Thermo Fisher) include siRNA for Toll-like receptor 3 (TLR3) (ID: s236), TLR7 (s27844), TLR9 (s28872), RIG-I (ID: s24143 and ID: s223616), and MDA5 (ID: s34498). A nontargeting siRNA was used as a negative control in every experiment (cat: 4404020).
6
Rbfox2 Depletion in Mouse Endothelial Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For transient depletion experiments, moEC were transfected with siRNAs against mouse Rbfox2 gene or non-silencing control (SMARTpool: Rbfox2 L-051552-01, Life Technologies; ON-TARGETplus non-targeting pool D-001810-10, Dharmacon, Lafayette, CO, USA) and the Lipofectamine RNAiMax kit (Life Technologies) in accordance with the manufacturer’s instructions. To achieve optimal knockdown efficiency, two subsequent transfections with 70 nM and 40 nM, respectively, of each siRNA oligo were performed with a 24 h interval, and ECs were analyzed 24 h after the second transfection.
7
siRNA-Mediated HcK Knockdown
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
siRNA targeting HcK were purchased from Santa Cruz Biotechnology and Dharmacon, and cells were transfected using the Lipofectamine RNAiMax kit (Life Technologies) according to the manufacturer’s instructions. Knockdown was confirmed by qPCR 48H post-transfection.
8
Transfection of HMGB1 siRNA and miR-200c mimic/inhibitor
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cell transfections with HMGB1 siRNA and miR-200c mimic and inhibitor were performed as described previously [24 (link)]. A549 cells were transfected with HMGB1 siRNA (AM16106; Life Technologies), miR-200c-3p mimic (MC11714; Life Technologies) or miR-200c inhibitor (MH11714; Life Technologies)using the Lipofectamine® RNAiMAX kit (Thermo Fisher Scientific). Transfection mixtures containing 0.25 ml of Lipofectamine® 2000 (Life Technologies), 25 ml of Opti-MEM™ (Life Technologies), and 10 nM siRNA or15 pmol/ml miR-200c inhibitor or mimic were incubated at room temperature for 10 min and then added to A549 cells seeded in 6-well plates in medium containing 10% (v/v) FBS. Cells were harvested after 48 h and analysed for miRNA expression using a miRNA extraction kit (Life Technologies) and quantitative RT-PCR.
9
Analyzing miR-98-3p Regulation in A549 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A549 cells were transfected with miR-98-3p mimic (MC24466; Life Science Technologies) or miR-98-3p inhibitor (MH24466; Life Science Technologies) using the Lipofectamine RNAiMAX kit (Thermo Fisher Scientific). Transfection mixtures containing 0.25 mL of Lipofectamine 2000 (Life Science Technologies), 25 mL of Opti-MEM (Life Science Technologies) and 15 nM miR-98 mimic were incubated at room temperature for 10 min, and added to A549 cells seeded in 6-well plates in 10% FBS-containing medium. Cells were harvested after 48 h and analyzed for miRNA expression using the miRNA extraction kit and quantitative RT-PCR.
10
Modulation of RCAN1 and JNK in Kidney Injury
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Small interfering RNA (siRNA) of RCAN1 (si-RCAN1) (sense: GCUCAGACCUUACACAUAGTT; antisense: CUAUGUGUAAGGUCUGAGCTT) or JNK (si-JNK) (sense: GUUCCCAGGUACAGAUCAUTT; antisense: AUGAUCUGUACCUGGGAACTT) and negative control (si-NC) were purchased from GenePharma (Suzhou, China). The si-NC, si-RCAN1, and si-JNK were individually transfected to subconfluent HK-2 cells at a final concentration of 50 nM using Lipofectamine RNAiMAX kit (Thermo Fisher, Waltham, MA, USA) according to the manufacturer’s instructions. Transfection reactions were carried out in serum-free Opti-MEM (Thermo Fisher). After transfection for 24 h, cells were cultured in serum-containing media and prepared for different experiments.
Considering that the expression level of RCAN1.1 S but not RCAN1.1 L increased in the kidney of I/R injury mice, and in the HK-2 cells with HR and cisplatin stimulus, we overexpressed RCAN1.1 S in HK-2 cells. In brief, the pCMV-EGFP-RCAN1.1 S (GFP-RCAN1) plasmid was designed and produced by GenePharma (Suzhou, China). HK-2 cells were then transfected with GFP-RCAN1 using lipofectamine 3000 reagent (Thermo Fisher) at ~70% confluency [13 ].
Considering that the expression level of RCAN1.1 S but not RCAN1.1 L increased in the kidney of I/R injury mice, and in the HK-2 cells with HR and cisplatin stimulus, we overexpressed RCAN1.1 S in HK-2 cells. In brief, the pCMV-EGFP-RCAN1.1 S (GFP-RCAN1) plasmid was designed and produced by GenePharma (Suzhou, China). HK-2 cells were then transfected with GFP-RCAN1 using lipofectamine 3000 reagent (Thermo Fisher) at ~70% confluency [13 ].
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!