Sybr green pcr master mix

Manufactured by Promega

Sourced in United States, Spain

SYBR Green PCR Master Mix is a ready-to-use solution for performing real-time PCR amplification and detection. It contains SYBR Green I dye, DNA polymerase, dNTPs, and necessary buffers and salts for efficient PCR reactions.

Automatically generated - may contain errors

Lab products found in correlation

Trizol reagent, by Thermo Fisher Scientific (24 mentions) Primescript rt reagent kit, by Takara Bio (10 mentions) Trizol, by Thermo Fisher Scientific (9 mentions) High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (6 mentions) Reverse transcription system, by Promega (5 mentions) Abi 7500 sequence detection system, by Thermo Fisher Scientific (5 mentions) Reverse transcription system kit, by Promega (4 mentions) Tri reagent, by Merck Group (4 mentions) M mlv reverse transcriptase, by Promega (4 mentions) Steponeplus real time pcr system, by Thermo Fisher Scientific (4 mentions) M mlv reverse transcriptase, by Takara Bio (4 mentions) Rnaiso plus, by Takara Bio (3 mentions) Sybr green kit, by Promega (3 mentions) Trizol, by Merck Group (3 mentions) Nanodrop nd 1000 spectrophotometer, by Thermo Fisher Scientific (3 mentions) Reverse transcription pcr kit, by iNtRON Biotechnology (2 mentions) Rneasy mini kit, by Qiagen (2 mentions) Trizol reagent, by Merck Group (2 mentions) Cdna synthesis kit, by Promega (2 mentions) 7900ht sequence detection system, by Thermo Fisher Scientific (2 mentions)

Close spelling variants of this product

SYBR Green Real-Time PCR Master Mixes (2 citations) SYBR master mix (5 citations) SYBR Green Mix (24 citations) PCR Master Mix (210 citations) SYBR Green (122 citations)

92 protocols using sybr green pcr master mix

Telomere Length Measurement in PBMCs

Check if the same lab product or an alternative is used in the 5 most similar protocols

Telomere length in PBMCs was measured using the methods described previously (Cawthon, 2009), with some modifications. We used 36B4 for reference as a single copy gene. The primer sequences (5′–3′) were: telomere forward: GGT TTT TGA GGG TGA GGG TGA GGG TGA GGG TGA GGG T; telomere reverse: TCC CGA CTA TCC CTA TCC CTA TCC CTA TCC CTA TCC CTA; 36B4 forward/reverse CAG CAA GTG GGA AGG TGT AAT CC; 36B4 forward/reverse CCC ATT CTA TCA TCA ACG GGT ACA A. The 36B4 reaction included 7.5 μL of SyBr Green PCR MasterMix (Promega, UK), 0.45 μL of primer forward, 0.75 μL of primer reverse and 3.3 μL of miliQ water. For telomere reaction: 7.5 μL of SyBr Green PCR MasterMix (Promega), 0.45 μL of primer forward, 0.45 μL of primer reverse and 3 μL of miliQ water.
The real-time polymerase chain reaction (PCR) was run with 7500 Fast Real Time PCR System (Promega, CA, USA) at 50°C for 2 minutes, then 40 cycles of 95°C for 2 minutes, 55°C for 15 seconds and 60°C for 1 minute.

Polho G.B., Cardillo G.M., Kerr D.S., Chile T., Gattaz W.F., Forlenza O.V., Brentani H.P, & De-Paula V.J. (2021). Antipsychotics preserve telomere length in peripheral blood mononuclear cells after acute oxidative stress injury. Neural Regeneration Research, 17(5), 1156-1160.

+ Open protocol

+ Expand

Adipogenic Gene Expression in 3T3-L1 Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA from 3T3-L1 cells was isolated using a RNeasy Mini Kit (Qiagen, Valencia, CA, USA). Complementary DNA was synthesized using a reverse transcription PCR kit (iNtRON Biotechnology, Gyeonggido, Republic of Korea). The mRNA levels of APE1/Ref-1, C/EBP-α, PPAR-γ, and aP2 were evaluated using qRT-PCR with the SYBR Green PCR Master Mix (Promega, Madison, WI, USA). qRT-PCR was performed according to the manufacturer’s protocol using QuantStudio 5 Real-Time PCR (Thermo Fisher Scientific, Waltham, MA, USA). The relative level of target mRNA expression was quantified using the ΔCt method, and glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was used as an internal control. All experiments were performed in duplicate and repeated three to four times. Three independent experiments were performed. The primer sequences for qRT-PCR were as follows: 5′-CCT CAC CCA GTG GCA AAT CTG-3′ and 5′-TCC ACA TTC CAG GAG CAT ATC T-3′ for APE1/Ref-1; 5′-GGA AGA CCA CTC GCA TTC CTT-3′ and 5′-GTA ATC AGC AAC CAT TGG GTC A-3′ for PPAR-γ; 5′-AAG GTG AAG AGC ATC ATA ACC CTA-3′ and 5′-TCA CGC CTT TCA TAA CAC ATT CC-3′ for aP2; 5′-CAA GAA CAG CAA CGA GTA CCG-3′ and 5′-GTC ACT GGT CAA CTC CGC AC-3′ for C/EBP-α; and 5′-AGG TCG GTG TGA ACG GAT TTG-3′ and 5′-TGT AGA CCA TGT AGT TGA GGT CA-3′ for GAPDH.

Lee E.O., Joo H.K., Lee Y.R., Kim S., Lee K.H., Lee S.D, & Jeon B.H. (2023). APE1/Ref-1 Inhibits Adipogenic Transcription Factors during Adipocyte Differentiation in 3T3-L1 Cells. International Journal of Molecular Sciences, 24(4), 3251.

+ Open protocol

+ Expand

Quantitative Analysis of CDK7 Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

The MCF-7 or LCC2 cells were seeded in six-well plates for 24 h and then treated with tamoxifen or/and THZ1. Forty-eight hours after treatment with tamoxifen and/or THZ1 and 72 h after transfection with CDK7 siRNA, the cells were typsinized and collected in tubes and then centrifuged for 5 min at 1200 rpm. The cellular total RNA was isolated from MCF-7 and LCC2 cells with Trizol reagent (Invitrogen), and cDNA was obtained from 1 μg of total RNA using a SuperScript II reverse transcription kit according to the manufacturer’s instructions (Invitrogen). The cDNA was then amplified by PCR with gene-specific primers for CDK7 and GAPDH on a CFX384 Touch Real-Time PCR Detection System (Bio-Rad Laboratories, Hercules, CA, USA) using SYBR Green PCR Master Mix (Promega) according to the manufacturer’s protocol. Fast amplification parameters were as follows: one cycle of 95 °C for 10 min, followed by 40 cycles of 95 °C for 15 s and 60 °C for 1 min. The primer sequences are shown in Table 1. Quantitative analysis of data was performed as described previously [60 (link)]. Values were normalized to GAPDH and are shown as relative expression levels.

Attia Y.M., Shouman S.A., Salama S.A., Ivan C., Elsayed A.M., Amero P., Rodriguez-Aguayo C, & Lopez-Berestein G. (2020). Blockade of CDK7 Reverses Endocrine Therapy Resistance in Breast Cancer. International Journal of Molecular Sciences, 21(8), 2974.

+ Open protocol

+ Expand

Quantitative Analysis of Aggrecan Expression in Ex Vivo IVD

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from NP tissue of IVD in ex vivo assay using TRIzol reagent (Sigma-Aldrich) according to the manufacturer’s instruction. The yield and purity of RNA were estimated spectrophotometrically using theA260/A280 ratio. Two micrograms of RNA was reverse-transcribed into complementary DNA using the SuperScript first-strand synthesis system (Invitrogen). One microliter of complementary DNA was subjected to quantitative reverse transcription-PCR amplification using SYBR GREENPCR Master Mix (Promega, Madison, WI, USA) and sequence-specific primers for Acan: 5′-
CAGATGGCACCCTCCGATAC-3′and 5′-
GACACACCTCGGAAGCAGAA-3′. The value of gene expression was normalized relative to the mouse GAPDH: 5′-
AATGTGTCCGTCGTGGATCTGA-3′ and 5′-
AGTGTAGCCCAAGATGCCCTTC-3′. PCR reactions were performed in triplicates. The data were analyzed using the 2^−ΔΔCT method.

Bian Q., Ma L., Jain A., Crane J.L., Kebaish K., Wan M., Zhang Z., Edward Guo X., Sponseller P.D., Séguin C.A., Riley L.H., Wang Y, & Cao X. (2017). Mechanosignaling activation of TGFβ maintains intervertebral disc homeostasis. Bone Research, 5, 17008-.

+ Open protocol

+ Expand

Real-time PCR Analysis of PRP-Treated Cancer Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

A2780 and BxPC3 were grown in 6 well plates and treated twice with PRP (T/C 0.07/0.42 mg/mL) on day 2 and on day 4. On day 5, total cellular RNA was isolated using TriReagent (Sigma) and reverse transcribed using the Reverse Transcription System kit (Promega). Real-time PCR was performed using the SYBR-Green PCR master mix (Promega) according to the manufacturer’s recommendations. PCR reactions were performed as follows: an initial denaturation at 95 °C for 2 min, 40 cycles of 95 °C for 5 s and 60 °C for 30 s, and final cycle of dissociation of 60–95 °C. The gene expression levels were normalized to corresponding GAPDH values and are shown as fold change relative to the value of the control sample. Untreated cells were used as a control. All the samples were done in triplicate for each gene. Primers used are shown in Supplementary Table S3.

Perán M., López-Ruiz E., García M.Á., Nadaraia-Hoke S., Brandt R., Marchal J.A, & Kenyon J. (2017). A formulation of pancreatic pro-enzymes provides potent anti-tumour efficacy: a pilot study focused on pancreatic and ovarian cancer. Scientific Reports, 7, 13998.

+ Open protocol

+ Expand

Transcriptional Profiling of SW480 Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from SW480 cells cultured in a 6-well plate with or without transfection of the small peptide plasmid by using TRIzol reagent (Invitrogen) according to the manufacturer’s instructions. cDNA was synthesized using a PrimeScript™ RT Reagent Kit (Takara Biotechnology, Dalian, China). One microliter of each cDNA product was subjected to RT-qPCR by using SYBR Green PCR Master Mix (Promega) with specific primers under the following cycle conditions, denaturation at 95ºC for 10 min, followed by 40 cycles at 95ºC for 15 s and 60ºC for 1 min. The gene expression levels were calculated using the 2
^−△△Ct method, and
GAPDH was selected as the internal control. The primers used for qPCR are listed in
Table 2.

Table 2 Sequence of primers used in the current study for qPCR

Gene	Forward sequence (5′→3′)	Reverse sequence (5′→3′)
BRAF	AGTACTCAGGAAAACACGACAT	CTTGGCGTGTAAGTAATCCATG
MCM3	GCCCGAACACTGGAAACTCTG	CCTGTGAGTCTGCCGTCTTTGGA
E2F1	ACGCTATGAGACCTCACTGAA	TCCTGGGTCAACCCCTCAAG
CCND1	ACCTGAGGAGCCCCAACAA	TCTGCTCCTGGCAGGCC
PLK1	GGCAACCTTTTCCTGAATGA	AATGGACCACACATCCACCT
MYC	GGAGGAACAAGAAGATGAGGAAGAA	AGGACCAGTGGGCTGTGAGGAG
GAPDH	GGAGCGAGATCCCTCCAAAAT	GGCTGTTGTCATACTTCTCATGG

Wen X., Sun X., Ou Z., Jiang J., Chen Q., He X., Hu Z., Qiao H., Zhou K., Li X., Deng Y, & Wen J. (2022). Phosphorylation-mediated interaction between human E26 transcription factor 1 and specific protein 1 is required for tumor cell migration: Ets1 and Sp1 interact to promote SW480 migration. Acta Biochimica et Biophysica Sinica, 54(10), 1441-1452.

+ Open protocol

+ Expand

Quantifying Tomato Tissue Transcripts

Check if the same lab product or an alternative is used in the 5 most similar protocols

The total RNA from each tissue, namely, the leaves, flowers, and roots, of three flowering tomato plants was extracted using TRIzol (Invitrogen) and purified using the RNA purification kit (Promega, Madison, WI USA). The concentration and purity of RNA were measured using Nanodrop (Thermo, Madison, WI, USA), and RNA integrity was detected by agarose gel electrophoresis. DNase was used to eliminate genomic DNA from the total RNA. Two micrograms of total RNA were used for cDNA synthesis using the GOSCRIPT Reverse transcriptional system (Promega). To determine the expression of lncRNA and transcripts of the coding gene, specific primers and SYBR Green PCR Master Mix (Promega) were used to perform qRT-PCR using Bio-Rad CFX manager 3.1 (Bio-Rad, Hercules, CA USA) [47 (link)]; actin was used as the standard. The data were analyzed by the 2^-ΔΔCt method [48 (link)]. All the results are expressed as mean ± standard deviation (SD) of three biological replicates. The primers used for qRT-PCR are listed in S1 Table.

Yang Z., Yang C., Wang Z., Yang Z., Chen D, & Wu Y. (2019). LncRNA expression profile and ceRNA analysis in tomato during flowering. PLoS ONE, 14(1), e0210650.

+ Open protocol

+ Expand

Quantitative gene expression analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was isolated from previously frozen livers (TRIzol, Sigma–Aldrich, Madrid, Spain) of 8-h fasted 4-month-old mice or randomly fed 15-day-old mice and used for cDNA synthesis (Promega). Transcript levels were then quantified by qPCR using SYBR Green PCR Master Mix (Promega). Results of the respective genes of interest were normalised to b-actin and subsequently median normalised to 1. The list of primers used is detailed in Supplementary Table 1.

Ribas-Aulinas F., Ribo S., Parra-Vargas M., Fernández-Pérez A., Cebrià J., Guardiola-Perello M., Ramon-Krauel M., Lerin C., Diaz R., Kalko S.G., Vallejo M., Díez-Noguera A., Cambras T, & Jimenez-Chillaron J.C. (2021). Neonatal overfeeding during lactation rapidly and permanently misaligns the hepatic circadian rhythm and programmes adult NAFLD. Molecular Metabolism, 45, 101162.

+ Open protocol

+ Expand

Quantitative Gene Expression Analysis in VSMCs

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from the VSMC using TRIzol reagent (Invitrogen, USA) according to the manufacturer's instructions. Synthesis of cDNA was performed using the total RNA by the reverse transcription system (Promega, USA) and oligo (dT) primers (Thermo Fisher Scientific, Inc., USA) according to the manufacturer's instructions. Real time reverse transcription polymerase chain reaction (RT-PCR) was performed using the Applied Biosystems 7900 real time RT-PCR System (Bio-RAD, USA), with SYBR Green PCR Master Mix (Promega). The primers were synthesized by TaKaRa Biological Engineering Company (China), as follows: β-actin forward: 5′-GGAGATTACTGCCCTGGCTCCTA-3′; β-actin reverse: 5′GACTCATCGTACTCCTGCTTGCTG-3′; c-fos forward: 5′-TCAATCCCTCCCTCCTTTACAC-3′; c-fos reverse: 5′-GTAGGATTTCGGGGATGGTTC-3′; SM α-actin forward: 5′-AGGGCTGTTTTCCCATCCAT-3′; SM α-actin reverse: 5′-GCTGTCCTTTTGGCCCATT-3′. The reaction conditions were: 95°C for 2 min, 1 cycle; 95°C for 15 s, 60°C for 1 min, 45 cycles. The threshold cycle (Ct) values of target genes were normalized to β-actin and are reported as relative to control taking control as 100%.

Yang Z., Zhang H., An M., Bian M., Song M., Guo X., Liu Q, & Qiu M. (2019). Total Panax notoginseng saponin inhibits balloon injury-induced neointimal hyperplasia in rat carotid artery models by suppressing pERK/p38 MAPK pathways. Brazilian Journal of Medical and Biological Research, 53(1), e9085.

+ Open protocol

+ Expand

Quantitative RNA Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total cellular RNA was isolated using TriReagent (Sigma) and reverse transcribed using the Reverse Transcription System kit (Promega). Real‐time PCR was performed using the SYBR‐Green PCR Master mix (Promega) according to the manufacturer's recommendations. PCR reactions were performed as follows: an initial denaturation at 95°C for 2 min, 40 cycles of 95°C for 5 s followed by 60°C for 30 s, and final cycle of dissociation of 60–95°C. The gene expression levels were normalized to corresponding GAPDH values and are shown as relative fold expression to the control sample. All samples were analyzed in triplicate for each gene. Primer sequences used are shown in Table 1.

Chocarro‐Wrona C., de Vicente J., Antich C., Jiménez G., Martínez‐Moreno D., Carrillo E., Montañez E., Gálvez‐Martín P., Perán M., López‐Ruiz E, & Marchal J.A. (2020). Validation of the 1,4‐butanediol thermoplastic polyurethane as a novel material for 3D bioprinting applications. Bioengineering & Translational Medicine, 6(1), e10192.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!