Superscript 3 reverse transcription reagent

Total RNA from the PC cell lines was extracted using a ZEB kit (Ebioscience). RNA was used for cDNA synthesis with the Superscript III Reverse Transcription Reagent (Life Technologies). The real-time PCR reaction was performed according to the protocol of the SYBR Premix Ex Taq kit (Takara) and using a StepOnePlus Real-Time PCR System (Applied Biosystems, USA). Primers are shown in Table S1.

Total RNA was extracted from mouse liver tissue with TRIzol (Invitrogen, Carlsbad, CA, USA). cDNA synthesis was performed with Superscript III reverse‐transcription reagent (Invitrogen) using 1 μg RNA. Quantitative real‐time PCR was conducted with SYBR Green I dye (Roche, Basel, Switzerland). PCR cycling started at 95°C for 30 seconds followed by 40 cycles of 95°C for 5 seconds and 60°C for 30 seconds, with the last step at 72°C for 20 min. The primer sequences used were listed in our previous study.⁹ Relative mRNA level changes were analyzed using the 2^−ΔΔCt method.

Total RNA was extracted from PC12 cells by using TriZol RNA extraction reagent (Invitrogen, CA, USA). Single-strand cDNA was synthesized using SuperScript III reverse transcription reagent (Invitrogen, CA, USA) according to the manufacturer's protocol. The specific primer sequences for each PCR reaction were listed in Table 1. The quantitative real-time PCR was performed on an ABI 7300 PCR System (Applied Biosystems, USA) using GoTaq qPCR Master Mix (Promega BioSciences, USA). Standard curves of the target genes were constructed with results of parallel PCR reactions performed on serial dilutions of a standard DNA. Fold change values were calculated by comparative Ct analysis after normalizing for the quantity of an endogenous reference gene β-actin mRNA in samples.

Total RNA was extracted from U251 cells by using TriZol RNA extraction reagent (Invitrogen). Single-strand cDNA was synthesized using SuperScript^® III reverse transcription reagent (Invitrogen) according to the manufacturer’s protocol. hnRNP A2/B1 was detected using the forward primer and the reverse primer 5’-GCAACCTTCTAACTACGGTCCA-3’, 5’-ATCTGCTCTGGTGTCTTCTGC-3’, Bcl-x was detected using the forward primer 5’-GGGTCTAGAAGTGGATGGTCAGTGTCTGGT-3’ and the reverse primer 5’-GGGGAATTCTTGGACAATGGACTGGTTGA-3’, where GAPDH was detected using the forward primer 5’-TGTTGCCATCAATGACCCCTT-3’ and the reverse primer 5’-CTCCACGACGTACTCAGCG-3’. Both Bcl-xL (779 bp) and Bcl-xS (590 bp) were amplified from the Bcl-x primers. PCR amplification was set as follows: after an initial denaturation at 94 °C for 2 min, 30 cycles of 94 °C for 30 s, 55 °C (hnRNP A2/B1)/63 °C (Bcl-x)/55 °C (GAPDH) for 30 s, and 72 °C for 60 s. The reaction ended with a final extension step at 72 °C for 5 min. PCR products were separated by gel electrophoresis in 1.2% agarose containing ethidium bromide and visualized under UV light.

Extraction of total RNA from snap frozen liver tissue was performed with TRIzol (Invitrogen, Carlsbad, CA, USA). Synthesis of cDNA was conducted using Superscript III reverse‐transcription reagent (Invitrogen) with 1 μg RNA. Quantitative real‐time PCR was performed with the SYBR Green I dye (Roche, Basel, Switzerland). The PCR cycling started at 95°C for 30 seconds followed by 40 cycles of 95°C for 5 seconds, 60°C for 30 seconds, with a last step at 72°C for 20 minutes. The primer sequences used were as follows: PI16 (forward), 5′‐ATATGGATCCACCATGCACGGCTCC‐3′; PI16 (reverse), 5′‐CGAATTCTCAGAAGATTCCAGCCAACACC‐3′; β‐actin (forward), 5′‐GTGGGGCGCCCCAGGCACCA‐3′; β‐actin (reverse), 5′‐CTCCTTAAGTCACGCACGATTTC‐3′. Relative mRNA levels changes were analyzed using 2^−ΔΔCt method.