Imager z2

Manufactured by Zeiss

Sourced in Germany, United States

The Zeiss Imager Z2 is a high-performance optical imaging system designed for advanced microscopy applications. It features a modular design and a range of specialized objectives to accommodate various sample types and research needs.

Automatically generated - may contain errors

Lab products found in correlation

Axiocam 506 mono, by Zeiss (6 mentions) 4 6 diamidino 2 phenylindole (dapi), by Merck Group (5 mentions) Apotome, by Zeiss (5 mentions) Apotome 2, by Zeiss (3 mentions) Axiovision 4, by Zeiss (3 mentions) Alexa fluor 488, by Thermo Fisher Scientific (3 mentions) Lsm 780 confocal microscope, by Zeiss (3 mentions) Lumar v12 stereomicroscope, by Zeiss (3 mentions) Ab20034, by Abcam (2 mentions) Polymer kit and fast blue, by Zytomed Systems (2 mentions) M7103, by Agilent Technologies (2 mentions) Metafer software, by MetaSystems (2 mentions) Axiocam icc3, by Zeiss (2 mentions) Hxp 120v fluorescent lamp, by Zeiss (2 mentions) Karyomax colcemid solution, by Thermo Fisher Scientific (2 mentions) Hyper spectral imaging system, by Applied Spectral Imaging (2 mentions) Eukitt, by Merck Group (2 mentions) C11440, by Hamamatsu Photonics (2 mentions) Lsm 880, by Zeiss (2 mentions) Axiovision rel 4, by Zeiss (2 mentions)

Close spelling variants of this product

Axio Imager Z2 microscope (326 citations) Axio Imager Z2 fluorescent microscope (16 citations) Axio Imager Z2 light microscope (12 citations) ApoTome Axio Imager Z2 (11 citations) Zeiss Imager Z2 fluorescence microscope (5 citations) Axio Imager Z2 LSM 700 Zeiss confocal microscope (4 citations) Axioplan Imager Z2 (4 citations) Axio Imager Z2 epifluorescence (4 citations) Axio Imager Z2 upright (4 citations) Imager Z2 upright fluorescent microscope (3 citations)

118 protocols using imager z2

Imaging Reporter Gene Expression in Worms

Check if the same lab product or an alternative is used in the 5 most similar protocols

Worms were anesthetized using 100 mM sodium azide (NaN₃) and mounted on 5% agarose pads on glass slides. Z-stack images (each ~0.7 µm thick) were acquired using a Zeiss confocal microscope (LSM880) or Zeiss compound microscope (Imager Z2) with the ZEN software. Maximum intensity projections of 2–30 slices were generated with the ImageJ software (Schindelin et al., 2012 (link)).
Reporter gene expression in different neurons was visualized in wild-type and mutant animals and usually assigned to one of the following categories: ‘on’ (fluorescence levels comparable to wild-type animals), ‘dim’ (fluorescence still detectable but much dimmer than wild-type animals), or ‘off’ (fluorescence not detectable). In cases were fluorescence levels were variable between animals and difference with wild type was not obvious mean fluorescence intensity in each neuron was measured with the ImageJ software.

Vidal B., Gulez B., Cao W.X., Leyva-Díaz E., Reilly M.B., Tekieli T, & Hobert O. (2022). The enteric nervous system of the C. elegans pharynx is specified by the Sine oculis-like homeobox gene ceh-34. eLife, 11, e76003.

+ Open protocol

+ Expand

Q-FISH Analysis of Telomere Integrity

Check if the same lab product or an alternative is used in the 5 most similar protocols

Telomere length and function (telomere integrity and chromosome stability) was estimated by Q-FISH (27 (link),28 (link)). Cells were incubated with 0.3 μg/ml nocodazole for 3 h to enrich cells at metaphases. Chromosome spreads were made by a routine method. Metaphase-enriched cells were exposed to hypotonic treatment with 0.075 M KCl solution, fixed with methanol: glacial acetic acid (3:1) and spread onto clean and cold slides. Telomeres were denatured at 80°C for 3 min and hybridized with FITC-labeled (CCCTAA) peptide nucleic acid (PNA) probe (F1009; Panagene) at 0.5 μg/ml. Chromosomes were counter-stained with 0.5 μg/ml DAPI. Fluorescence from chromosomes and telomeres was digitally imaged on a Zeiss Imager Z2 microscope with FITC/DAPI filters, using AxioCam and AxioVision software 4.6. For quantitative measurement of telomere length, telomere fluorescence intensity was integrated using the TFL-TELO program (a gift kindly provided by P. Lansdorp, Terry Fox Laboratory).

Zhou Z., Wang L., Ge F., Gong P., Wang H., Wang F., Chen L, & Liu L. (2018). Pold3 is required for genomic stability and telomere integrity in embryonic stem cells and meiosis. Nucleic Acids Research, 46(7), 3468-3486.

+ Open protocol

+ Expand

Histological Staining of Mouse Retina and Brain

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Adult mouse retinas and brain sections were stained, processed, and imaged as previously described (Tudor C Badea, Cahill, et al., 2009 (link); Tudor Constantin Badea & Nathans, 2004 (link); T. C. Badea, Wang, & Nathans, 2003 (link)). Mice were anesthetized with ketamine and xylazine and fixed by intracardiac perfusion with 4% Paraformaldehyde (PFA). Retinas and brains were dissected and post-fixed in 4% PFA for 45 minutes or 2 hours respectively. Retinas were flat-mounted and brains were sliced coronally at 200 μm thickness using a vibratome (Leica). Retinal flat-mounts and brain sections were washed in PBS and heat inactivated in a water bath at 65°C for one hour to inactivate the endogenous AP activity. Staining was performed in AP buffer (0.1mM Tris, 0.1M NaCl, 50mM MgCl2, pH9.5), with 0.34 mg/ml nitroblue tetrazolium (NBT) and 0.35 mg/ml 5-bromo-4-chloro-3indolyl-phosphate (BCIP; Roche), for 1–12 hours at room temperature with gentle agitation. Following multiple washes in PBS – 0.1% Tween 20 and an ethanol dehydration series, stained retinas and brains were mounted in benzyl:benzoate: benzyl alcohol (BB:BA, 2:1). Low resolution images of brain sections were acquired on a Zeiss Discovery V8 Stereomicroscope, using a Zeiss Axiocam MRC color camera, and Axiovision software. Color images of retinal flat-mounts were acquired using a Zeiss Imager.Z2.

Parmhans N., Fuller A.D., Nguyen E., Chuang K., Swygart D., Wienbar S.R., Lin T., Kozmik Z., Dong L., Schwartz G.W, & Badea T.C. (2020). Identification of Retinal Ganglion Cell Types and Brain Nuclei expressing the transcription factor Brn3c/Pou4f3 using a Cre recombinase knock-in allele.. The Journal of comparative neurology, 529(8), 1926-1953.

+ Open protocol

+ Expand

Whole-Mount In Situ Hybridization of Mouse Embryos

Check if the same lab product or an alternative is used in the 5 most similar protocols

Embryos were dissected from time mating females into cold PBS containing 10% FBS and were fixed overnight in 4% paraformaldehyde in PBS containing 0.1% Tween-20 at 4 °C (PBT). Single-color whole mount in situ hybridization was carried out as described^{81 (link)}. RNA probes were either labelled with digoxygenin (DIG - Roche Diagnostics, Germany) or FITC (Roche Diagnostics, Germany). The riboprobe template for Fam208a was prepared using the primers Fwd- ACCACTGGAGAAGCCTGAGA and Rev- GGAATCTTCCTGCTGCACTC and templates for T, Nodal, Cer1, Foxa2, Shh, Noto, Wnt3, Eomes, Gbx2, Lim1, and Otx2 were obtained from Prof. Janet Rossant and were used previously^{82 (link)}. After post-fixing overnight in 4% paraformaldehyde, embryos were imaged using an inverted microscope (SteREO Discovery V12, Zeiss). Selected embryos were then washed 5–6 times in PBT, embedded in agarose and then embedded in paraffin for sectioning at 3 µm for haematoxylin and eosin (H&E) staining. Sections were imaged using a Zeiss Imager.Z2 equipped with objective N-Achroplan 40x/0.65 M27 and ZEN Software for image acquisition.

Bhargava S., Cox B., Polydorou C., Gresakova V., Korinek V., Strnad H., Sedlacek R., Epp T.A, & Chawengsaksophak K. (2017). The epigenetic modifier Fam208a is required to maintain epiblast cell fitness. Scientific Reports, 7, 9322.

+ Open protocol

+ Expand

Detecting DNA Strand Breaks in LECs

Check if the same lab product or an alternative is used in the 5 most similar protocols

DNA strand breaks were detected in cultured LECs using a Roche TMR Red Cell Death Detection Kit (Roche Diagnostics Corporation, Indianapolis, IN, USA) following UV-exposure of the cells in 4-well chamber slides. TMR Red detects both single- and double-stranded DNA breaks that occur at early stages of apoptosis. Photographs were taken using a Zeiss Axio Imager .Z2 fluorescence microscope with an attached Axio Cam camera and Axio Vision software, version 4.8.2.

Cencer C.S., Chintala S.K., Townsend T.J., Feldmann D.P., Awrow M.A., Putris N.A., Geno M.E., Donovan M.G, & Giblin F.J. (2017). PARP-1/PAR Activity in Cultured Human Lens Epithelial Cells Exposed to Two Levels of UVB Light. Photochemistry and photobiology, 94(1), 126-138.

+ Open protocol

+ Expand

Metaphase Spread Analysis for Karyotyping

Check if the same lab product or an alternative is used in the 5 most similar protocols

At least 30 metaphase spreads per individual were analyzed to confirm the 2n, karyotype structure and FISH results. Metaphases were analyzed in an epifluorescent microscope (Imager Z2, Zeiss, Germany), and images were captured with the software Axiovision 4.8 (Zeiss, Germany). Final editing of images used Corel Photo Paint X5.

de Oliveira T.D., Kretschmer R., Bertocchi N.A., Degrandi T.M., de Oliveira E.H., Cioffi M.D., Garnero A.D, & Gunski R.J. (2017). Genomic Organization of Repetitive DNA in Woodpeckers (Aves, Piciformes): Implications for Karyotype and ZW Sex Chromosome Differentiation. PLoS ONE, 12(1), e0169987.

+ Open protocol

+ Expand

Quantifying DNA Methylation Signals in Micronuclei

Check if the same lab product or an alternative is used in the 5 most similar protocols

After 5mC immunodetection, slides were analyzed using a Carl Zeiss Imager Z2 fluorescence microscope with fluorescent lighting HSP, 120 W. The images were recorded with an AxioCam ICc5 digital camera and immersion lens with a ×100 magnification. The specific location of the cell nuclei with the micronuclei was also recorded. After subsequent FISH, the same slides were analyzed using the same equipment. The specific locations for each previously recorded cell nucleus and micronucleus were found after FISH and hybridization signals were captured. The frequencies of MN with specific signals and without signals were calculated. For the group treated with MH, a total of 350 nuclei with MN were evaluated. In order to analyze the presence of DNA methylation signals within the rDNA foci, 50 MN with rDNA signals were evaluated.

Bara-Halama A.W., Idziak-Helmcke D, & Kwasniewska J. (2022). Unraveling the DNA Methylation in the rDNA Foci in Mutagen-Induced Brachypodium distachyon Micronuclei. International Journal of Molecular Sciences, 23(12), 6797.

+ Open protocol

+ Expand

Immunohistochemical Analysis of Lung and Liver

Check if the same lab product or an alternative is used in the 5 most similar protocols

Formalin-fixed paraffin-embedded lung sections were stained with Alcian blue Elastin Van Gieson and immunostained for αSMA (α-smooth muscle actin; 1:150; Dako, M0851), von Willebrand factor (1:300; Dako, A0082), NF-κB (nuclear factor kappa-B; 1:400; Cell Signaling, D14E12), F4/80 (1:100; Abcam, ab111101), iNOS (inducible NO synthase; 1:100; Abcam, ab15323), and CD206 (1:100; R&D Systems, AF2535). As isotype control, IgG and IgG2a were used. Formalin-fixed paraffin-embedded liver sections were stained with anti-F4/80 to confirm macrophage ablation. For immunohistochemical and immunofluorescent staining, a standard protocol was followed. Histological images were visualized using a Zeiss multislide scanning microscope (Imager.Z2; Carl Zeiss, Ltd) with an Axiocam 506 color camera (Zeiss) for immunohistochemical images and MRm camera (Zeiss) for immunofluorescent images. Slides were scanned sequentially using ×20 magnification objective lens, and the analysis was performed in Zen2 blue edition (Zeiss). For all tissue macrophage quantification, positively stained cells were counted in 6 fields of view at ×200 magnification and normalized to the control group.

Zawia A., Arnold N.D., West L., Pickworth J.A., Turton H., Iremonger J., Braithwaite A.T., Cañedo J., Johnston S.A., Thompson A.A., Miller G, & Lawrie A. (2020). Altered Macrophage Polarization Induces Experimental Pulmonary Hypertension and Is Observed in Patients With Pulmonary Arterial Hypertension. Arteriosclerosis, Thrombosis, and Vascular Biology, 41(1), 430-445.

+ Open protocol

+ Expand

Immunofluorescence Staining of PD-L1 Protein

Check if the same lab product or an alternative is used in the 5 most similar protocols

Sections were deparaffinized and rehydrated, and antigen retrieval was performed. The immunofluorescence staining was conducted with Dako mouse anti-PD-L1 22C3 (1:50) paired with Yeasen anti-mouse IgG labeled with Alexa Fluor 594 (1:100) and Cell Signaling Technology rabbit anti-PD-L1 E1L3N (1:400) paired with Yeasen anti-rabbit IgG labeled with Alexa Fluor 488 (1:100). All of the images were captured with ZEISS Imager.Z2 at a magnification of ×400.

Zhang W., Cao Z., Gao C., Huang Y., Wu C., Zhang L, & Hou L. (2020). High concordance of programmed death-ligand 1 expression with immunohistochemistry detection between antibody clones 22C3 and E1L3N in non-small cell lung cancer biopsy samples. Translational Cancer Research, 9(10), 5819-5828.

+ Open protocol

+ Expand

Multicolor Fluorescence Microscopy of Cell Nuclei

Check if the same lab product or an alternative is used in the 5 most similar protocols

After hybridization, the slides were washed twice with SSPE, dehydrated in a gradient of concentrated ethanol solutions, stained with DAPI and examined under a fluorescence microscope (Zeiss Axio Imager Z2) with the following fluorescence filter sets: DAPI (SP-100), Spectrum Green^™ (MF101), Cy3^™ v1 (SP-102), Texas Red (SP-107), Cy5 (50) and PF-415 (45). Advanced 3D imaging software (AxioVision Rel. 4.8) was used with the microscope. Specifically, a microscopic field with a monolayer of tissues or cells of interest was selected and located in the DAPI filter channel using automatic relocation software (AxioVision Rel. 4 Module Mark & Find 2). The fluorescence images were recorded using a high-resolution charge-coupled device (CCD) in five filter channels, including Spectrum Green^™, Cy3^™ v1, Texas Red, Cy5 and PF-415. The 25–30 layers of stereoscopic tomography images for each photographed cell nucleus were acquired using the Z-Stack module, and then the multiple layers of fluorescence signals were ultimately merged into a single layer to achieve a clear, stable and satisfactory five-color image.

Hu L., Yin X., Sun J., Zetterberg A., Miao W, & Cheng T. (2016). A molecular pathology method for sequential fluorescence in situ hybridization for multi-gene analysis at the single-cell level. Oncotarget, 8(31), 50534-50541.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!