Sybr select

RNA was extracted by using TRIzol Reagent (Thermo) according to the manufacturer’s protocol. cDNA was synthesized using a High-Capacity cDNA Reverse Transcription Kit (Thermo). qRT-PCR was performed using SYBR Select (Thermo Scientific, Hong Kong, China) following the manufacturer’s protocol. β-actin was used as the internal control. Primers used for quantitative PCR were: TNFα-forward 5′-GGTGCCTATGTCTCAGCCTCTT-3′; TNFα-reverse 5′-GCCATAGAACTGATGAGAGGGAG-3′; IL-1β-forward 5′-TGGACCTTCCAGGATGAGGAC-3′; IL-1β-reverse 5′-GTTCATCTCGGAGCCTGTAGTG-3′; IL-6-forward 5′-TACCACTTCACAAGTCGGAGGC-3′; IL-6-reverse 5′-CTGCAAGTGCATCATCGTTGTTC-3′; β-actin-forward 5′-CCTGAGCGCAAGTACTCTGTGT-3′; β-actin-reverse 5′-GCTGATCCACATCTGCTGGAA-3′; CD68-forward 5′-CCCAAGGAACAGAGGAAG-3′; CD68-reverse 5′-GTGGCAGGGTTATGAGTG-3′; aSMA-forward 5′-CCCAGACATCAGGGAGTAATGG-3′; aSMA-reverse 5′- TCTATCGGATACTTCAGCGTCA3′; PCNA-forward 5′- TGCTCTGAGGTACCTGAACT-3′; PCNA-reverse 5′- TGCTTCCTC ATCTTCAATCT-3′; ICAM1- forward 5′- CAATTTCTCATGCCGCACAG-3′; ICAM1-reverse 5′- AGCTGGAAGATCGAAAGTCCG-3′; MCP1-forward 5′- CCCAATGAGTAGGCTGGAGA-3′; MCP1-reverse 5′- AAAATGGATCCACACCTTGC-3′; IL18-forward 5′- ACTGTACAACCGCAGTAATACGC-3′; IL18-reverse 5′- AGTGAACATTACAGATTTATCCC-3′; CRP-forward 5′- AGCCTCTCTCATGCTTTTGG-3′; and CRP-reverse 5′- TGTCTCTTGGTGGCATACGA-3′.

RNA was isolated using Isol-RNA lysis procedure (5 Prime). RNA was DNase (Thermo Fisher Scientific) treated and then reversely transcribed by MMLV (Promega). Semi-quantitative PCR was performed in Eppendorf Mastercycler using a standard protocol. Quantitative RT–PCR was performed in triplicate with SYBR select (Thermo Fisher Scientific) using Rotor-Gene 3000 (Qiagen). Normal human RNAs were obtained from Agilent Technologies. All other RNAs were isolated from cultured cancer cell lines. Primers for RT-PCR were upper primer CCTTCCTTCCTGGGCATGGAGTC and lower primer CGGAGTACTTGCGCTCAGGAGGA for ACTB (226 bp), upper primer AGCTGGGCAAGGAGCGGCTG and lower primer GGTGGGGCCGTTTAGGGTCCA for ZAR1 (264 bp) and upper primer TGGAGAAGGCTGGGGCTCAT and lower primer GACCTTGGCCAGGGGTGCTA for GAPDH (176 bp). Student’s t test was used for statistical analysis.

RNA was isolated from human cell culture using Trizol-RNA lysis procedure (Thermo Fisher Scientific). RNA was DNaseI (Thermo Fisher Scientific) treated and then reversely transcribed by MMLV (Promega). Quantitative RT–PCR was performed in triplicate with SYBR select (Thermo Fisher Scientific) using Rotor-Gene 3000 (Qiagen) and normalized to GAPDH/ACTB level. Primers for RT–PCR are listed in Table S1.
We performed RNA microarrays (Clariom S human) according to manufacturer’s protocol (P/N 703174 Rev. 2) with 200 ng of total RNA. Reagents/equipment were GeneChip wt PLUS Reagent Kit, P/N: 902280; GeneChip Hybridization, Wash, and Stain Kit P/N 900720, GeneChip Scanner, GeneChip Fluidics Station 450, GeneChip Hybridization Oven 640, Bioanalyzer 2100 (Agilent), and RNA600 NanoKit (Agilent).

Singleplex telomere length qPCR was performed with a QuantStudio 6 Flex Real-Time PCR System and analyzed as described previously [5 (link), 22 (link), 23 (link)]. The qPCR was performed on QuantStudio 6 Flex Real-Time PCR System (Thermo Fisher Scientific) in 10 μL volume of PCR reaction with 1× SYBR Select (Thermo Fisher Scientific), primers, and DNA as template. The telomere primers (telg and telc) and β-globin gene primers (hbgu and hbgd) were used for this assay. Each DNA standard curve was generated using a pooled female genomic DNA (Promega, G152A) and used for calculation of the T/S ratios (= ratios of “telomere quantities/single copy gene quantities”). All experimental DNA samples were repeated at least three times in duplicate. All replicate samples had a standard deviation of less than 0.5 for the threshold cycle (Ct) values.