Genomic DNA was isolated from peripheral blood samples by using the BioRobot EZ1Workstation (Qiagen, Hilden, Germany). RAB27A, LYST, AP3B1, and PRF1 genes were analyzed by means of direct sequencing. The coding exons and exon-intron boundaries were amplified and directly sequenced in both directions with the BigDye Terminator Cycle Sequencing Ready Reaction Kit (Applied Biosystems, Foster City, Calif). Sequences obtained with an ABI Prism 3130XL Sequence Detection System (Applied Biosystems) were analyzed and compared with the reported gene structure by using the dedicated software SeqScape (Applied Biosystems). All mutations were confirmed in the parents.
Seqscape
Manufactured by Thermo Fisher Scientific
Sourced in United States, France
SeqScape is a software application designed for the analysis and comparison of DNA sequence data. It provides a comprehensive set of tools for sequence alignment, variant detection, and data visualization.
Automatically generated - may contain errors
Lab products found in correlation
3730 dna analyzer, by Thermo Fisher Scientific (6 mentions)
Multiscreen system, by Merck Group (5 mentions)
Montage system, by Merck Group (5 mentions)
Sequencher software, by Gene Codes (5 mentions)
Abi 3730 genetic analyzer, by Thermo Fisher Scientific (4 mentions)
Big dye chemistry, by Thermo Fisher Scientific (4 mentions)
Bigdyeterm v1.1 cycleseq kit, by Thermo Fisher Scientific (3 mentions)
Bigdye terminator v3.1 cycle sequencing kit, by Thermo Fisher Scientific (3 mentions)
Gotaq dna polymerase, by Promega (2 mentions)
Abi 3130xl, by Thermo Fisher Scientific (2 mentions)
Bigdye terminator chemistry, by Thermo Fisher Scientific (2 mentions)
Abi 3130 genetic analyzer, by Thermo Fisher Scientific (2 mentions)
Bigdye terminator cycle sequencing ready reaction kit, by Thermo Fisher Scientific (1 mentions)
Biorobot ez1 workstation, by Qiagen (1 mentions)
Multiscreen 96 well filter plate, by Merck Group (1 mentions)
Sephadex g 50, by GE Healthcare (1 mentions)
Exosap it, by Thermo Fisher Scientific (1 mentions)
Kapa 2g fast hs readymix pcr kit, by Roche (1 mentions)
Sequence scanner version 1, by Thermo Fisher Scientific (1 mentions)
Geneamp high fidelity pcr system, by Thermo Fisher Scientific (1 mentions)
37 protocols using seqscape
1
Genetic Analysis of Immune Disorders
2
Genetic Screening of GRN Mutation Families
3
Variant Confirmation by Sanger Sequencing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
All most likely pathogenic variants were confirmed with direct PCR and Sanger sequencing. Pair of oligonucleotides were manually designed at least 50 bp upstream and downstream from the mutation for PCR-amplification and sequencing. Amplicons were enzymatically purified (ExoSAP-IT, USB Corporation, Cleveland, Ohio, USA purchased from GE Healthcare, Orsay, France) and sequenced with a commercially available sequencing mix (BigDyeTerm v1.1 CycleSeq kit, Applied Biosystems, Courtabœuf, France). The sequenced products were purified on a pre-soaked Sephadex G-50 (GE Healthcare) 96-well multiscreen filter plate (Millipore, Molsheim, France), the purified product analyzed on an automated 48-capillary sequencer (ABI 3730 Genetic analyzer, Applied Biosystems) and the results interpreted by applying a software (SeqScape, Applied Biosystems). The nomenclature of each variant was checked applying Mutalyzer (https://mutalyzer.nl/check ) to concord with the Human Variation Genome Society guidelines for mutation nomenclature (http://www.hgvs.org/mutnomen/ ).
When blood samples from family members were available, co-segregation analysis was performed to confirm association of selected variants with the phenotype.
When blood samples from family members were available, co-segregation analysis was performed to confirm association of selected variants with the phenotype.
4
Mutational Analysis of FIS Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For mutational analysis of the genes, PCR was performed on DNA from 53 individuals from seven FIS families from the KS clinical subset using the HotStarTaq amplification protocol (Qiagen). For the sequencing of CNEs and LOC285577, PCR from 46 of these individuals was carried out using the KAPA 2G Fast HS ReadyMix PCR Kit (KAPA Biosystems, Wilmington, MA). The reactions were analyzed on 3730 DNA Sequencers (Applied Biosystems, Grand Island, NY).
DNA isolated from blood samples of 100 controls consisting of individuals who married into FIS families, and who did not have FIS, were amplified with rs117273909 primers using GeneAmp High Fidelity PCR System (Applied Biosystems, Grand Island, NY). The products were sequenced on an Applied Biosystems / Hitachi 3730 Genetic Analyzer. Sequencing analysis was performed using Sequencing Analysis version 5.2, and Sequence Scanner version 1.0 (both from Applied Biosystems, Grand Island, NY). Alignments of DNA sequences were done with SeqScape (Applied Biosystems, Grand Island, NY), Sequencher (Gene Codes Corporation, Ann Arbor, MI), and CodonCode Alignment software (v 3.7.1.1).
DNA isolated from blood samples of 100 controls consisting of individuals who married into FIS families, and who did not have FIS, were amplified with rs117273909 primers using GeneAmp High Fidelity PCR System (Applied Biosystems, Grand Island, NY). The products were sequenced on an Applied Biosystems / Hitachi 3730 Genetic Analyzer. Sequencing analysis was performed using Sequencing Analysis version 5.2, and Sequence Scanner version 1.0 (both from Applied Biosystems, Grand Island, NY). Alignments of DNA sequences were done with SeqScape (Applied Biosystems, Grand Island, NY), Sequencher (Gene Codes Corporation, Ann Arbor, MI), and CodonCode Alignment software (v 3.7.1.1).
5
Sequence Analysis of RAB3GAP1 and ABCD1
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The sequences of exon 5 of RAB3GAP1 and exon 1 of ABCD1 (ATP-binding cassette D1 subtype) were analyzed using PCR with the primer pairs listed in Supplementary Table 1 (in the online-only Data Supplement). PCR amplicons were then analyzed by direct DNA sequencing. DNA sequencing reactions were performed using the BigDye Terminator cycle sequencing kit (version 3.1, Life Technologies, Thermo Fisher Scientific, Carlsbad, CA, USA) and capillary electrophoresis on the ABI 3500 sequencer (Applied Biosystems, Thermo Fisher Scientific, Waltham, MA, USA). Sequence data were analyzed using Sequencing Analyzed Software (version 6.0; Thermo Fisher Scientific, Waltham, MA, USA) and Applied Biosystems SeqScape (version 3.0) software. The NCBI sequences NM_012233.3 and NM_000033 were used as reference sequences for RAB3GAP1 and ABCD1, respectively.
6
PDE6b gene mutation analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
PDE6brd1 mutations were investigated by direct Sanger sequencing. Genomic DNA was extracted using 50 mM NaOH for 30 min at 95°C. The following primers were used Forward: 5’ctgcacacagacatccagtc 3’ Reverse: 5’ccatgcctggctgaagttgt 3’. PCR was done using a Gotaq DNA Polymerase (Promega). Next, PRC products were sequenced using Sanger sequencing (BigDyeTermv1.1 CycleSeq kit, Applied Biosystems) and analyzed on an automated 48-capillary sequencer (ABI3730 Genetic analyzer, Applied Biosystems), and the results interpreted by applying a software (Seqscape, Applied Biosystems).
7
EGFR Mutation Analysis in Tumors
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Tissue samples submitted for mutational analysis were obtained through biopsy or surgical resection. Genomic DNA of the tumor specimen was extracted using a microdissection method based on the manufacturer's protocols. The nucleotide sequences encoding the kinase domain (exons 18–24) of EGFR were amplified via a quantitative real-time polymerase chain reaction (PCR)-based method (qPCR). The presence of an appropriate PCR product was confirmed by resolving the PCR products on a 2% agarose gel. After purification, corresponding fragments on the gel were sequenced in both sense and antisense directions using an ABI PRISM® 9700 and ABI PRISM® 310 Genetic Analyzer (Applied Biosystems, USA). The sequenced data using SeqScape (Applied Biosystems) were analyzed and compared with the archived human sequence of EGFR (GenBank accession no. NG_007726.1 ), to identify the mutation. Of the 115 patients who were tested for somatic mutations, 64 patients were mutant-type of EGFR, whereas 51 patients tested negatively for the EGFR mutation (wild-type of EGFR).
8
Comprehensive VWF and ABO Gene Sequencing
Check if the same lab product or an alternative is used in the 5 most similar protocols
Sanger sequencing was used to resequence the complete exons 26 and 28 and confirm all putative mutations discovered with Ion Torrent sequencing. The human genomic sequence was obtained from genomic build GRCh37p13. Primers for the 52 different exons of the
VWFgene and exon 7 of the
ABOgene (
Supplementary Table S2 ) were designed using NCBI Primer-BLAST (
http://www.ncbi.nlm.nih.gov/tools/primer-blast/index.cgi ) and ordered from DNA Technology A/S (Risskov, Denmark). The samples were sequenced using Big Dye Terminator chemistry, v3.1 (Applied Biosystems, Foster City, California, United States) on an ABI 3130xl sequencer. PCR was performed using KAPA Taq HotStart DNA PCR kit (KAPA Biosystems, Cape Town, South Africa). The primary PCR products were purified with ExoSAP-IT PCR Product Cleanup (Affymetrix, Santa Clara, California, United States), unincorporated dye terminators removed by BigDye XTerminator Purification Kit and sequence data assembled and compared using SeqScape (Applied Biosystems).
+ Expand
Sanger sequencing was used to resequence the complete exons 26 and 28 and confirm all putative mutations discovered with Ion Torrent sequencing. The human genomic sequence was obtained from genomic build GRCh37p13. Primers for the 52 different exons of the
VWFgene and exon 7 of the
ABOgene (
9
Genetic Analysis of GIST Tumors
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Archived formalin-fixed, paraffin-embedded (FFPE) tissues of histologically and immunohistochemically proven GIST tumor samples were used for testing KIT exons 9, 11, 13, and 17 by PCR. Purified PCR products were subjected to direct DNA sequencing in both directions using BigDye version 3.1 cycle sequencing kit (Applied Biosystems, USA). Sequences were analyzed using sequence analysis software SeqScape® (Applied Biosystems) and Chromas Lite (Technelysium Pvt. Ltd) and were compared with the wild-type KIT reference sequence, with the mutations being reported as per the recommendations of the Human Genome Variation Society. The reference sequence used in this study is KIT (gene ID 3815). The Single Nucleotide Polymorphism database (dbSNP), Catalogue of Somatic Mutations in Cancer (COSMIC), and ensembl databases were referred before considering the abnormal results as “novel mutations.” Samples which were nonamplified, with noise or with nonreadable sequences, were repeated once before considering them as uninterpretable.
10
Sanger Sequencing Validation of Variants
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The selected candidate variants were confirmed by Sanger sequencing using ABI 3130XL and SeqScape software (Applied Biosystems; Foster City, CA, USA). The primers for Sanger sequencing are listed in Table S5 .
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!