Abi prism 7500 real time pcr

Total RNA was extracted via the phenol/chloroform method using TRIzol reagent (Invitrogen). Quantitative polymerase chain reaction (PCR) was performed using EXPRESS One-Step SYBR® GreenER™ Kit (Invitrogen, USA). Emissions from the SYBR Green reporter dye were monitored with an ABI Prism 7500 Real Time PCR (Applied Biosystems). The primer sequences used were as follows:
Mult1, 5′-CAATGTCTCTGTCCTCGGAA-3′ (sense), Mult1, 5′-CTGAACACGTCTCAGGCACT-3′ (antisense); H60a, 5′-TGCCTGATTCTGAGCCTTTTCA-3′ (sense), H60a, 5′-ATTCACTGAGCACTGTCCATGTAGAT-3′ (antisense); H60b, 5′-AGCCTTTTGGTCCTGCTGAAT-3′ (sense), H60b, 5′-ATGTTTTTTATCACCAAAATCAAGGAGT-3′ (antisense); H60c, 5′-CTTCTCTTGATCCTGGAGTCCTGTAGT-3′ (sense), H60c, 5′-GAGAGTCTTTCCATTCACTGAGCAC-3′ (antisense); β-actin, 5′-TTCTACAATGAGCTGCGT-3′ (sense), β-actin, 5′-ATCACAATGCCTGTGGTA-3′ (antisense). All expression levels of interested genes were normalized to the housekeeping gene β-actin. Gene expression values were then calculated based on the ΔΔCt method.

The small intestine mucosal tissues were cut to sections and total RNAs were extracted using TRIzol reagent (Invitrogen, USA) according to the manufacturer’s protocol. The purity and concentration of RNAs were determined by Nano Drop 2000 (Thermo, Scientific, USA), and cDNAs (2 μg) were synthesized by PrimeScript RT Master Mix kit (Takara, China). QRT-PCR was conducted in ABI PRISM 7500 real-time PCR (Applied Biosystems, USA) by SYBR PCR Master Mix (Applied Biosystems, USA), and the PCR cycles were set as follows: pretreatment at 95 °C for 30 s, followed by 40 cycles at 95 °C for 5 s, at 60 °C for 30 s, finally at 70 °C for 30 s, and preserved at 4 °C. Gene relative expressions were calculated by 2^-ΔΔCT. The primer sequences used were listed in Table 1. U6 served as the endogenous control.
Table 1

The qRT-PCR primer sequences

Name	Forward primer: 5′-3’	Reverse primer: 5′-3’
miR-320	AAAAGCTGGGTTGAGAGGG	TGCGTGTCGTGGAGTC

Total RNA was isolated from serum, tissue, and BC cell lines using a Trizol reagent (Takara Biotechnology Co., Ltd., Dalian, China) according to the manufacturer’s instructions. The purity of the extracted RNA was determined by spectrophotometry at 260/280 nm, and 5μg purified total RNA was reverse transcribed into cDNA using the PrimeScript RT reagent kit (Cat# RR037A, Takara, China). Quantitative real-time PCR (qPCR) reactions were performed on ABI Prism 7500 real time PCR instrument (Applied Biosystems, USA) using the SYBR Green PCR Master Mix (Takara, Japan). The PCR conditions were as follows: one cycle of 50°C for 2 min and 95°C for 10 min, followed by 40 cycles of 95 °C for 30 s and 60 °C for 30 s. The relative expression of the target gene was determined by 2–ΔΔCt method. GAPDH was selected as the internal control gene for normalizing the expression. The primer sequences used for RT-qPCR were listed below [16 (link)]: GAPDH forward primer 5′- TCCCATCACCATCTTCCAGG -3′, reverse primer 5′-GATGACCCTTTTGGCTCCC-3′; circPRMT5 forward primer 5′- TACCATTGGCCTCTAGCCCT-3′, reverse primer 5′- CAAGGGGAATCACAGCCCAT-3′.