Magna lyser green bead tubes

Whole mouse lungs were homogenized in 2 ml MagNA lyser Green Bead tubes (Roche Applied Science) with 1 mL TRI-reagent (Molecular Research Center, Inc.) at 6000 rpm for 1 min. Homogenates were transferred to 1.5 mL RNase-free safe-lock tubes (Eppendorf) containing 1 mL of TRI-reagent (Molecular Research Center). For RNA isolation with TRI-reagent, the manufacturer’s protocol for phase separation and RNA precipitation were followed except that samples were placed at -80 °C overnight after adding isopropanol.
To complete the isolation, tubes were thawed on ice, RNA was pelleted by centrifugation (12,000 rpm, 45 min, 4 °C), and pellets were washed twice with cold 75% RNase-free ethanol (1 mL, 12,000 rpm, 10 min, 4 °C). After removing the ethanol wash, RNA pellets were dried for 3–5 min on the bench top, and then resuspended in 50 µL RNase-free water. RNA was stored at -80 °C until microarray labeling. RNA integrity was evaluated using the Agilent RNA 6000 Nano Kit and 2100 BioAnalyzer according to the product handbooks. RNA quantity was measured using a DU 800 UV/Vis Spectrophotometer (Beckman Coulter).

Total RNA was extracted from the frozen IOZCAS-Ha-I cell pellets or H. armigera tissues with the miRNeasy Mini Kit (Qiagen, Venlo, The Netherlands), including the DNase digestion step, following the manufacturer’s instructions. The tissue samples were homogenized by shredding in MagNA Lyser Green Bead Tubes (Roche, Basel, Switzerland) with a MagNA Lyser instrument (30 s, 6500 rpm, Roche). A fixed volume of 300 µL (cells) or 350 µL (tissues) was sampled from the aqueous phase, and the purified RNA was eluted in 25 µL RNase-free water.

Total DNA was isolated from conjunctival bacterial swabs by both mechanical and enzymatic lysis. Samples were thawed and transferred to sterile MagNA Lyser Green Bead Tubes (Roche) and bead-beaten twice to achieve mechanical lysis at 6000 rpm for 30 seconds in a MagNA Lyser instrument (Roche). Unused swabs and unused buffer tubes without swabs served as negative controls for sample collection and DNA isolation. Samples were subjected to enzymatic lysis by incubating them with 2.5-μl lysozyme (100 mg/ml: Carl Roth) at 37° C for 1 hour. Further processing was performed using a QIAamp DNA microbiome kit (#51704, Qiagen) according to the manufacturer's instructions. Total DNA was eluted in 35 μl of the AE buffer included in the kit. Total DNA was stored at −20° C until polymerase chain reaction (PCR) amplification. All procedures were performed under sterile conditions in a laminar flow unit.

Cells were harvested with QIAzol^® Lysis Reagent, and QIAGEN RNeasy Plus 96 Kit was used for RNA purification. The cell lysates were homogenized for 70 s at 6500 rpm with MagNA Lyser Green Bead tubes in the MagnaLyser (Roche Diagnostics). RNase-Free DNase Set (QIAGEN Cat No. 79254) was used to remove genomic DNA contamination on column.
After RNA purification, reverse transcription samples were generated with Invitrogen™ SuperScript™ III First-Strand Synthesis SuperMix for qRT-polymerase chain reaction (PCR).
KCNH2 expression was evaluated by droplet digital PCR (ddPCR) and the concentrations of mRNA was recorded and analyzed with NanoDrop 8000. Hprt1 was measured as a housekeeping gene in CHO cells and used for normalization of KCNH2 expression levels. Duplicate samples from two independent experiments were analyzed at each condition.

Stool samples were immediately frozen and stored at -80°C until semi-automated DNA isolation. Approximately 175mg of stool was homogenized in MagnaLyser Green Bead tubes by using the MagnaLyser Instrument (Roche Diagnostics, Mannheim, Germany) according to manufacturer’s instructions. Total genomic DNA was isolated with the MagNA Pure LC DNA Isolation Kit III (Bacteria, Fungi) in a MagNA Pure LC 2.0 Instrument (Roche Diagnostics, Mannheim, Germany) according to manufacturer’s instructions. Enzyme cocktail II (Roche Diagnostics, Mannheim, Germany) with 100μg lysozyme (Karl Roth GmbH, Karlsruhe, Germany) per 100μl sample was used according to manufacturer’s instructions.
The 16S rRNA gene was amplified using FLX 454 one way read (Lib-L kit, Primer A, Primer B, Roche 454 Life Science, Branford, CT, USA) (S1 Table) fusion primers with the template specific sequence F27—AGAGTTTGATCCTGGCTCAG and R534—ATTACCGCGGCTGCTGGC targeting the V1-V3 hypervariable regions [23 (link), 24 (link)] as described previously in Kump et al. 2013. [25 (link)]

L1/L2 larvae were collected via pipette in 200–300 µl of PBS then added directly to lysing matrix D (1.4-mm ceramic spheres, MagNA Lyser Green Bead tubes, Roche) along with 1 ml of TRIzol LS. A PreCellys 24 (Bertin) was used to homogenize the samples by bead beating 3× for 20 s at 6000 rpm, placing the samples on wet ice to cool between runs. Homogenized samples were transferred to 1.5 ml microfuge tubes and total RNA extracted by adding 400 µl of Chloroform, shaking vigorously and incubating for 5 min at RT. Samples were centrifuged at 12,000 × g for 15 min at RT, then the upper aqueous phase was transferred to a new microfuge tube prior to addition of 800 µl Isopropyl alcohol with 2 µl GlycoBlue (Invitrogen). Tubes were placed at −80 °C overnight and then centrifuged at 12,000 × g for 10 min at 4 °C. The supernatant was removed, being careful not to disturb the blue pellet, and the pellet washed in 1 ml 75% ethanol. The pellet was air-dried briefly then resuspended in nuclease-free water. Total RNA was quantified by Bioanalyzer (Agilent). Multiplexed cDNA libraries were generated from 300 pg of total high-quality RNA according to the SmartSeq2 protocol by Picelli et al.^{69 (link)}, and 125 bp paired-end reads were generated on an Illumina HiSeq according to the manufacturer’s standard sequencing protocol.

For each timepoint and condition, collected insects were selected at random and pooled in four groups of three. The frozen cadavers were crushed to a fine powder using a liquid-nitrogen-cooled mortar and pestle. A 50 mg sample of powdered tissue was disrupted in 1 mL QIAzol lysis reagent (Qiagen) by shredding (30 s, 6500 rpm) in MagNA Lyser Green Bead Tubes (Roche) with a MagNA Lyser instrument (Roche). The total RNA was extracted using the RNeasy Lipid Tissue Mini Kit (Qiagen) following the manufacturer’s instructions. The DNase digestion step was included to prevent DNA contamination. The purified RNA was eluted in 50 µL RNase-free water.
For sRNA sequencing, total RNA was extracted from 50 mg of selected samples using the miRNeasy Mini Kit (Qiagen), including the DNase digestion step, following the manufacturer’s instructions.