We extracted RNA from BMSCs via column affinity purification (QIAGEN, Hilden, Germany) and synthesized complementary DNAs (cDNAs) using M-MuLV RT Master Mix with Oligo(dT) (Sangon Biotech, Shanghai, China). We performed real-time PCR on a StepOnePlus system (Applied Biosystems, Foster City, CA, USA) in 96-well plates with specific primers and SYBR Green Mix (Sangon Biotech). The primers (Sangon Biotech) were as follows: Lnc Tmem235-F: GGGAGAAGGT CATCTCAGGCA; Lnc Tmem235-R: GCTGTTGCTGCCTTTCTCAAGT; Lnc LOC102553514-F: CAGCGTCAGACCTCCGTCTA; Lnc LOC102553514-R: TTAA GCATTGCGGGTGCCAA; BIRC5-F: TGCCTTACGCTGAGCCTTTGC; BIRC5-R: GCCTGGAAAGCTGGGACAAGTG; miRNA-34a-3p-F: CGCGCGAATCAGCAA GTATACT; miRNA-34a-3p-R: AGTGC AGGGTCCGAGGTATT; miRNA-34a-3p-RT: GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACTAGGGC; ACTB-F: CACCCGCGAGTACAACCTTC; and ACTB-R: CCCATACCCACCATCA CACC. We calculated the fold change in RNA expression compared to that of the control using the ΔΔCt method.
Column affinity purification
Manufactured by Qiagen
Sourced in Germany
Column affinity purification is a laboratory technique used to separate and purify specific molecules or proteins from a complex mixture. It involves the use of a column filled with a solid support material, such as beads or resin, that has been modified to selectively bind the target molecule. The mixture is passed through the column, and the target molecule is retained while other components are washed away. The bound molecule can then be eluted, or released, from the column using a specific buffer or solution. This method provides a reliable and efficient way to isolate and purify target analytes for further analysis or application.
Automatically generated - may contain errors
Lab products found in correlation
Steponeplus system, by Thermo Fisher Scientific (4 mentions)
M mulv rt master mix, by Sangon (2 mentions)
Oligo dt, by Sangon (2 mentions)
Sybr green mix, by Sangon (2 mentions)
Rabbit primers, by Sangon (1 mentions)
Superscript 2, by Thermo Fisher Scientific (1 mentions)
Sybr green mastermix, by Eurogentec (1 mentions)
Sybr green mix, by Bio-Rad (1 mentions)
4 protocols using column affinity purification
1
Quantitative real-time PCR analysis of lncRNAs and miRNA-34a-3p in BMSCs
2
Gene Expression Analysis of BMSCs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
We extracted RNA from BMSCs via column affinity purification (QIAGEN, Hilden, Germany) and synthesized complementary DNAs (cDNAs) using M-MuLV RT Master Mix with Oligo(dT) (Sangon Biotech, Shanghai, China). We performed RT-PCR on a StepOnePlus system (Applied Biosystems, California, USA) in 96-well plates with specific primers and SYBR Green Mix (Sangon Biotech). Rabbit primers (Sangon Biotech) were as follows: Parkin-F: TGACCAGTTGCGTGTGATCTTCG; Parkin-R: GTTGTCTCCTCCAGGCGTGTTG; P53-F: ATGGAGGAG TCGCAGTCGGATC; P53-R: GGTGGTCAGCAGGTTGTTCTCAG; ACTB-F: TCCCTGGAGAAGAGCTACGA; ACTB-R: GTACAGGT CCTTGCGGATGT. We calculated the fold change value of mRNA expression over that of control using the ΔΔCt method.
3
Real-Time PCR Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using column affinity purification (Qiagen, Courtaboeuf, France) according to the manufacturer’s instructions. Complementary DNA was synthetized using Superscript II reverse transcriptase (Life Technologies Corporation, Carlsbad, CA, USA) and random hexamers. Real-time PCR was performed in a Step One Plus system (Applied Biosystems, Warrington, UK), using the SYBR Green MasterMix (Eurogentec, Liège, Belgium). Oligonucleotide primers were designed and used as previously reported [40 (link)] and sequences are available upon request. Relative gene expression was calculated using the 2ΔΔCt method with 18S ribosomal RNA as an internal control.
4
Profiling Gene Expression in H9C2 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The extraction of RNA from H9C2 cells was performed using column affinity purification (Qiagen). cDNAs were synthesized using the iScript RT master mix (Bio‐Rad) with random hexamers. Real‐time PCR was performed on a StepOnePlus system (Applied Biosystems) in 96‐well plates with specific primers and SYBR green mix (Bio‐Rad). The rat primers were as follows: PGC‐1α‐F: CACCAAACCCACAGAGAACAG, PGC‐1α‐R: GCAGTTCCAGAGAGTTCCACA; PGC1‐β‐F: TTGTGTCAAGGTGGATGGCA and PGC‐1β‐R: GCACCGAAGTGAGGTGCTTA; p21‐F: TGCCGAAGTCAGTTCCTTGT and p21‐R: GTTCTGACATGGCGCCTCC; p16‐F: CTTCGGCTGACTGGCTGG and p16‐R: TCATCATGACCTGGATCGGC; p15‐F: GGGACTAGTGGAGAAGGTGC and p15‐R: CATCATCATGACCTGGATCGC. GAPDH was used as an endogenous control as follows: GAPDH‐F: TCTCTGCTCCTCCCTGTTCTA and GAPDH‐R: TCCGATACGGCCAAATCCGTT. The relative mRNA expression levels were calculated by applying the following equation: 2−∆Ct, and the fold‐change value of expression compared to control was calculated following the ΔΔCt method.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!