Platinum sybr green kit

Manufactured by Thermo Fisher Scientific

Sourced in United States, Germany

The Platinum SYBR Green Kit is a real-time PCR reagent kit that enables the detection and quantification of DNA sequences using the SYBR Green fluorescent dye. The kit includes a proprietary Platinum Taq DNA polymerase, SYBR Green I dye, and optimized buffer components for reliable and sensitive PCR amplification.

Automatically generated - may contain errors

Lab products found in correlation

13 protocols using platinum sybr green kit

Quantitative Analysis of Hepatic HBV DNA

Check if the same lab product or an alternative is used in the 5 most similar protocols

Hepatic HBV DNA was extracted with the QIAamp DNA Mini kit (Qiagen) according to the manufacturer’s instructions. Southern blot analysis was performed as previously described44 (link). Hepatic HBV DNA was quantified by PCR using the Platinum SYBR Green Kit (Invitrogen/Life technologies, Darmstadt, Germany) with the sense primer 5′-TGC CTC ATC TTC TTR TTG GTT CT-3′ and the antisense primer 5′-CCC CAA WAC CAK ATC ATC CAT ATA-3′. The primer contained wobble bases (r = purine (A,G), w = weak binding (A,T) and k = keto (G,T)).

Real C.I., Lu M., Liu J., Huang X., Trippler M., Hossbach M., Deckert J., Jahn-Hofmann K., Ickenstein L.M., John M.J., Gibbert K., Dittmer U., Vornlocher H.P., Schirmbeck R., Gerken G., Schlaak J.F, & Broering R. (2016). Hepatitis B virus genome replication triggers toll-like receptor 3-dependent interferon responses in the absence of hepatitis B surface antigen. Scientific Reports, 6, 24865.

+ Open protocol

+ Expand

HBV DNA Extraction and Quantification

Check if the same lab product or an alternative is used in the 5 most similar protocols

Serum HBV DNA was extracted by using QiAamp DNA Blood Mini kit (Qiagen) and quantified by real time PCR using a Platinum SYBR green Kit (Invitrogen) as described [35 (link), 41 (link)].

Dietze K.K., Schimmer S., Kretzmer F., Wang J., Lin Y., Huang X., Wu W., Wang B., Lu M., Dittmer U., Yang D, & Liu J. (2016). Characterization of the Treg Response in the Hepatitis B Virus Hydrodynamic Injection Mouse Model. PLoS ONE, 11(3), e0151717.

+ Open protocol

+ Expand

Quantitative RT-PCR Analysis of Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

For qRT‐PCR experiments, first‐strand cDNA was synthesized from 1 μg of total RNA in a volume of 20 μL with oligo‐d(T)₁₇ and Superscript III (Invitrogen Life Technology, Carlsbad, CA, USA), following the manufacturer’s instructions. The cDNA concentration in the RT mix was quantified using a ND‐1000 UV spectrophotometer (Nanodrop Technologies, Wilmington, DE, USA), and 1 μg of cDNA was used for qRT‐PCR experiments, employing an MX3000 thermal cycler (Stratagene, La Jolla, CA, USA) and Platinum Sybr‐Green Kit (Invitrogen Life Technology), according to the manufacturer’s instructions. The elongation factor 1α gene, having constitutive expression, was used to normalize raw data and to calculate relative transcript levels. The primer sequences used in qRT‐PCR are displayed in Table S1.

Merino M.C., Guidarelli M., Negrini F., De Biase D., Pession A, & Baraldi E. (2019). Induced expression of the Fragaria × ananassa Rapid alkalinization factor‐33‐like gene decreases anthracnose ontogenic resistance of unripe strawberry fruit stages. Molecular Plant Pathology, 20(9), 1252-1263.

+ Open protocol

+ Expand

Quantitative HBV Viral Markers

Check if the same lab product or an alternative is used in the 5 most similar protocols

The serum HBsAg and HBeAg levels were determined using the Architect System and HBsAg and HBeAg CMIA kits (Abbott Laboratories, Wiesbaden-Delkenheim, Germany) according to the manufacturer’s instructions. Serum HBV DNA was extracted using the QiAamp DNA Blood Mini kit (Qiagen) and quantified by real-time PCR using a Platinum SYBR Green Kit (Invitrogen, Thermo Fisher Scientific, Waltham, MA, USA) as described.^{28 (link)}

Ma Z., Liu J., Wu W., Zhang E., Zhang X., Li Q., Zelinskyy G., Buer J., Dittmer U., Kirschning C.J, & Lu M. (2017). The IL-1R/TLR signaling pathway is essential for efficient CD8+ T-cell responses against hepatitis B virus in the hydrodynamic injection mouse model. Cellular and Molecular Immunology, 14(12), 997-1008.

+ Open protocol

+ Expand

Quantitative RT-PCR for Gene Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Quantitative RT-PCR (RT-qPCR) was performed in triplicate using the Platinum Sybr Green Kit (Invitrogen) on an Applied Biosystems Fast 7500 machine. Detection of CCND1 ORF abundance was performed using Relative Quantitation (RQ) settings, and was normalized to the total integrated ORF library using primers targeting the PGK promoter as the endogenous control (CCND1 Forward: 5′ GCTGTGCATCTACACCGACA 3′; Reverse: 5′ TTGAGCTTGTTCACCAGGAG 3′. PGK Forward: 5′ CAA CCG GCT CCG TTC TTT GG 3′; Reverse: 5′ CAC GAG ACT AGT GAG ACG TGC TA 3′). Detection of combined genomic DNA (gDNA) and plasmid signal using CMV or PGK primers was performed using RQ settings, and was normalized to total gDNA using primers targeting the GAPDH promoter as the endogenous control (CMV Forward: 5′ TGGCATTATGCCCAGTACATGACC 3′; Reverse: 5′ CCATTGATGTACTGCCAAAACCGC 3′. GAPDH Forward: 5′ ATC CAA GCG TGT AAG GGT CC 3′; Reverse: 5′ GGA CTG AGA TTG GCC CGA TG 3′). Detection of shRNA half-hairpins was performed in this same manner, using primers JH353F (5′ TAGTGAAGCCACAGATGTA 3′) and HHR2L (5′ ATGTATCAAAGAGATAGCAAGGTATTCAG 3′), with GAPDH promoter as the endogenous normalization control.

Sack L.M., Davoli T., Xu Q., Li M.Z, & Elledge S.J. (2016). Sources of Error in Mammalian Genetic Screens. G3: Genes|Genomes|Genetics, 6(9), 2781-2790.

+ Open protocol

+ Expand

Quantitative Real-Time PCR Analysis of Leptin Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA from epididymal adipose tissues was extracted using TRIzol reagent (Life Technologies, France) according to the manufacturer’s instructions. Total RNA (0.5 µg) was reverse transcribed with mouse myeloblastosis virus reverse transcriptase (Promega) under standard conditions using hexanucleotide random primers according to the manufacturer’s instructions. cDNA was amplified by PCR with specific primers. Real-time PCR was performed on the Light Cycler Instrument (Roche Diagnostics) using the Platinum SYBR Green kit (Invitrogen). Specific primers for mouse leptin and two mouse housekeeping genes used for normalization (β-actin and 34B4 mouse genes) were purchased from Sigma (Sigma, France). We used primers for Leptin (forward,AAC CTG GAA ATG CTC TGG CTGT; reverse,ACT CGC TGT GAA TGG CCT GAA A), 36B4F (forward,

TCC AGG CTT TGG GCA TCA

; reverse,CTT TAT CAG CTG CAC ATC ACT CAG A), and β-actin (forward, CTA AGG CCA ACC GTG AAA AG; reverse, CCT GCT TCA CCA CCT TCT TG).

Raad G., Serra F., Martin L., Derieppe M.A., Gilleron J., Costa V.L., Pisani D.F., Amri E.Z., Trabucchi M, & Grandjean V. (2021). Paternal multigenerational exposure to an obesogenic diet drives epigenetic predisposition to metabolic diseases in mice. eLife, 10, e61736.

+ Open protocol

+ Expand

Quantitative Analysis of TGM2 Isoforms

Check if the same lab product or an alternative is used in the 5 most similar protocols

Real-time RT-PCR was performed on cDNA isolated from EAC, BE, and normal gastric or esophageal mucosa samples using either the 96-well StepOne Plus or 384-well 7900HT Systems (Applied Biosystems) and the Platinum SYBR Green kit (Invitrogen). All primers were designed using NCBI Primer-BLAST and the primer sequences for TGM2 are: TGM2 all isoforms, forward CCAACTACAACTCGGCCCAT, and reverse CTGGTCATCCACGACTCCAC targeting between exons 7 and 8; long isoform (NCBI NM_004613), forward GCAGGGGAGGAAGTTAAGGTGAGAA, and reverse GGCGGGGCCAATGATGACA targeting exon 13; common short isoform (NCBI NM_198951), forward GGTAAAGCCCTGTGTTCCTG, and reverse AGCGCCATGTAAGTGTCTGTG targeting its unique portion in exon 10. Genomic primers for TGM2 are for intron 2 forward GTGGCCGGGCTGGGATGG and reverse AAGGTGGGGTCGGGGTTTGAGG and for intron 11 forward ATCCTTATCATCGCCATCATCATCATTATA and reverse ACTGCCGCTCCCTCTGCTGTTTA. Annealing temperatures were determined and optimized using Cepheid SmartCycler (Cepheid, Anaheim, CA). Expression values and copy number changes were determined by the 2^−ΔΔCt algorithm.^{31 (link)} Reference genes (GAPDH and ACTB) were applied to normalize the 2^−ΔΔCt calculation of Ct values of each target gene.

Leicht D.T., Kausar T., Wang Z., Ferrer-Torres D., Wang T.D., Thomas D.G., Lin J., Chang A.C., Lin L, & Beer D.G. (2014). TGM2 A Cell Surface Marker in Esophageal Adenocarcinomas. Journal of thoracic oncology : official publication of the International Association for the Study of Lung Cancer, 9(6), 872-881.

+ Open protocol

+ Expand

Gene Expression Analysis Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

Gene expression analysis was carried out as described before24 (link)54 (link). RNA was isolated using the RNeasy Mini Kit from Qiagen (Hilden, Germany) according to the manufacturer's instructions. Subsequently residual remaining DNA was digested with DNase I. Reverse transcription was performed with 1 μg RNA and random primers using qScript from Quanta Biosciences according to the manufacturers' protocol. Additionally each sample was analysed without reverse transcription. The signals obtained without RT were neglectable (<1%). Finally, realtime amplification was performed with the Stratagene Mx3005P using the Platinum SYBR Green kit (Invitrogen, Karlsruhe, Germany) according to the manufacturer's instructions. Primer sequences, names of the corresponding proteins, ref-sequences, as well as annealing temperature and fragment length are given in supplementary table S1. qPCR efficiency was >90%. All primers for genes of interest are intron-spanning and have been validated by RT-PCR and gel electrophoresis. Furthermore, the primers were validated by melting curve analysis. The relative expression of the two genes of interest was calculated using the 18S signal for normalization. Each sample was analysed as triplicate. All values are expressed as mean ± standard error of mean normalized to the wildtype control group.

Schreier B., Rabe S., Winter S., Ruhs S., Mildenberger S., Schneider B., Sibilia M., Gotthardt M., Kempe S., Mäder K., Grossmann C, & Gekle M. (2014). Moderate inappropriately high aldosterone/NaCl constellation in mice: cardiovascular effects and the role of cardiovascular epidermal growth factor receptor. Scientific Reports, 4, 7430.

+ Open protocol

+ Expand

Quantitative PCR Analysis of Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted using Trizol (Invitrogen, Carlsbad, CA, USA). RNA concentration and purity were determined spectrophotometrically by measuring fluorescence at 260 and 280 nm. Three micrograms of RNA was reverse transcribed into cDNA using Superscript III (Invitrogen) transcription reagents according to the manufacturer’s instructions. After obtaining the cDNA, gene expression was quantified by quantitative PCR using Platinum SYBRGreen Kit (Invitrogen) in Mx3005P detector equipment (Stratagene, Santa Clara, CA, USA). The following primers were used: BCR–ABL 5′-TGGGTCCAGCGAGAAGGTT-3′ (forward) and 5′-GCATTCCGCTGACCATCAAT-3′ (reverse); GAPDH 5′-GGAGAAGGCTGGGGCTCAT-3′ (forward) and 5′-TCCTTCCACGATACCAAAGTT-3′ (reverse); TRAIL 5′-AAGGCTCTGGGCCGCAAAATAAAC-3′ (forward) and 5′-CCAACTAAAAAGGCCCCGAAAAA-3′ (reverse); DR4 5′-GTACGCCCTGGAGTGACATC-3′ (forward) and 5′-CCTCGTAGGAGACCCAAGC-3′ (reverse); DR5 5′-CTAGCTCCCCAGCAGAGAGT-3′ (forward) and 5′-GTGGTGCAGGGACTTAGCTC-3′ (reverse). WASP 5′-GGCTGGTCGGCTGCTCTGGGAACA-3′ (forward) and 5′-GGTGGTGGGGGTAGCTGGCGTCTGT-3′ (reverse). Results were given as relative expression represented as 2^−ΔΔCt.

Pereira W.O., De Carvalho D.D., Zenteno M.E., Ribeiro B.F., Jacysyn J.F., Sardinha L.R., Zanichelli M.A., Hamerschlak N., Jones G.E., Pagnano K.B., Castro F.A., Calle Y, & Amarante-Mendes G.P. (2017). BCR–ABL1-induced downregulation of WASP in chronic myeloid leukemia involves epigenetic modification and contributes to malignancy. Cell Death & Disease, 8(10), e3114-.

+ Open protocol

+ Expand

Quantifying WHV DNA by Real-time PCR

Check if the same lab product or an alternative is used in the 5 most similar protocols

WHV DNA was quantified by real-time PCR using Platinum SYBR Green Kit (Invitrogen) as described previously [28] (link).

Liu J., Zhang E., Ma Z., Wu W., Kosinska A., Zhang X., Möller I., Seiz P., Glebe D., Wang B., Yang D., Lu M, & Roggendorf M. (2014). Enhancing Virus-Specific Immunity In Vivo by Combining Therapeutic Vaccination and PD-L1 Blockade in Chronic Hepadnaviral Infection. PLoS Pathogens, 10(1), e1003856.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!