Mopc21

U373 MG cells stably expressing hepaCAM were treated overnight with a monoclonal antibody against the extracellular hepaCAM domain (clone 419305; R&D Systems, Minneapolis, MN, USA) at a concentration of 10 μg/ml. Mouse IgG1 (MOPC-21; Sigma-Aldrich) was used as an isotype control.

The ChIP assay was performed as described previously.¹⁸, ¹⁹ Chromatin solution (2 ml) was incubated overnight with 2 μg of anti‐myc antibodies (PL14) and control mouse antibody (MOPC21; SIGMA‐Aldrich, St Louis, MO). DNA was purified and subjected to qPCR analysis as described above. We used the following PCR primers: amplicon 1 (between −2023 and −1821 from the transcription start site of the HMGA2 gene predicted from RefSeq NM_003483.6), 5′‐AGCAGCCTGAAAACAAGTGG‐3′ (sense) and 5′‐GGGGAGTCACTGAGGAGTTC‐3′ (antisense); amplicon 2 (between −660 and −484), 5′‐GCATGTCTCCGTGTATGTGC‐3′ (sense) and 5′‐GAGCCAACACTTTGCAGGAA‐3′ (antisense). Per cent input values were calculated by comparing Ct values of input and immunoprecipitated fractions and were shown as ratios relative to those of control samples.

The rabbit anti-Tspan9 polyclonal antibody was as previously described [15], anti-α-tubulin monoclonal DM1A was from Sigma, anti-phosphotyrosine monoclonal 4G10 was from Millipore, anti-LAT phospho-specific antibodies were from Abcam, anti-human GPVI monoclonal HY101 for biochemical experiments was kindly provided by Dr Peter Smethurst (NHS Blood and Transplant, Cambridge, UK), anti-human GPVI monoclonal 1G5 for microscopy was kindly provided by Dr Elizabeth Gardiner (The John Curtin School of Medical Research, Canberra, Australia) [29] and mouse IgG1 isotype control monoclonal MOPC-21 was from Sigma. Fluorescently labelled monoclonal antibodies used for flow cytometry and single particle tracking were from Emfret, apart from anti-mouse integrin α6 (AbD Serotec), anti-mouse CLEC-2 17D9 [30] and anti-ADAM10 and anti-CD9 (R&D Systems). Atto 647N and 565 fluorescent dyes were from Sigma, and 3,3′-dihexyloxacarbocyanine iodide (DiOC6) membrane dye was from Molecular Probes. Platelet agonists were cross-linked collagen-related peptide (CRP) from Prof Richard Farndale (Cambridge University, UK), Horm collagen from Takeda, ADP from Sigma, protease-activated receptor (PAR)-4 peptide (AYPGKF) from Alta Bioscience and arachidonic acid from Cambridge Bioscience.

Size determination of MVs_MUC1 was performed by Nanoparticle Tracking Analysis (NTA) technology (30 (link)). MVs were thawed on ice and diluted in PBS between 1:500 and 1:20,000 to achieve the optimal number of MVs/mL. Three videos (30 s each) were recorded for each sample loading, employing the NanoSight NS300 instrument (Malvern Instruments Ltd, Malvern, UK). Measurements were performed employing the NTA 2.3 analytical software. Results were shown as the average of the three recordings.
MUC1 expression on MVs_MUC1 was evaluated by flow cytometry. MVs_MUC1 (5 μg/sample) were incubated with the anti-MUC1 MoAb Ma552 (Monosan) (1:100 for 30 min, 50 μL/sample, RT). After washing in PBS w/o Mg⁺⁺ and Ca⁺⁺(1 mL/sample, 30 min at 13,000 rpm, RT), MVs_MUC1 were incubated with FITC-conjugated anti-mouse antibody (1:600; Jackson-Immunoresearch Laboratories, 50 μL/sample). MoAb MOPC21 (1:100; Sigma-Aldrich) was employed as isotype control. To exclude background noise, flow cytometry analysis was performed setting the lowest Forward Scatter Threshold [300] and the highest FSC/SSC voltage. A total of 30,000 events were acquired with low flow rate, using a FACSCanto II flow cytometer running FACSDiva data acquisition and analysis software (Becton Dickinson).

DC phenotype staining was performed using the following antibodies directly conjugated with fluorescein isothiocyanate (FITC) or phycoerythrin (PE): IgG₁-FITC and IgG₁-PE as isotype controls (both from Biolegend); anti-HLAII-DR-FITC, anti-CD86-FITC, anti-CD83-PE (all from BD Biosciences), anti-CD40-PE, anti-CD14-PE, and anti-CCR7-FITC (all from Biolegend). DCs (2 × 10⁵ cells/50μL sample) were incubated with conjugated MoAb (according to the manufacturer's recommendation) for 30 min at room temperature (RT). After washing (in 2 mL of PBS w/o Mg⁺⁺ and Ca⁺⁺, centrifuged at 250 × g for 5 min), cell pellet was resuspended in PBS (100 μL); at least 1 × 10⁴ events were evaluated using a FACSCanto II flow cytometer running FACSDiva data acquisition and analysis software (Becton Dickinson).
To evaluate MUC1 expressed by MUC1-DG75 cells, 1 × 10⁵ cells were incubated with MoAb Ma552 (1:40; Monosan, Netherlands, 50 μL/sample) for 30 min at RT and binding revealed with FITC-conjugated anti-mouse antibody (1:600; Jackson-Immunoresearch Laboratories, PA, USA). MoAb MOPC21 (1:100; Sigma-Aldrich, 50 μL/sample) was employed as isotype control.