Takara primescript 1st strand cdna synthesis kit

Manufactured by Takara Bio

Sourced in Japan

The TaKaRa PrimeScript 1st Strand cDNA Synthesis Kit is a laboratory tool used for the reverse transcription of RNA into complementary DNA (cDNA). It includes the necessary reagents and enzymes required for this process.

Automatically generated - may contain errors

Lab products found in correlation

Powerup sybr green master mix, by Thermo Fisher Scientific (4 mentions) Trizol, by Thermo Fisher Scientific (2 mentions) Abi stepone real time pcr system, by Thermo Fisher Scientific (2 mentions) Easy spin total rna extraction kit, by iNtRON Biotechnology (2 mentions) Cfx96 real time pcr detection system, by Bio-Rad (2 mentions) Sybr green qpcr master mix, by MedChemExpress (1 mentions) Iq5 multicolor qrt pcr detection system, by Bio-Rad (1 mentions) Plant total rna extraction kit, by Tiangen Biotech (1 mentions) T100 thermocycler, by Bio-Rad (1 mentions) Rneasy micro kit, by Qiagen (1 mentions) Nucleospin rna xs, by Macherey-Nagel (1 mentions) Sybr green supermix, by Bio-Rad (1 mentions)

Close spelling variants of this product

PrimeScriptTM 1st-strand cDNA synthesis TAKARA PrimeScript Kit PrimeScript™ Synthesis kit PrimeScriptTM cDNA kit CDNA synthesis kit Takara kit PrimeScript kit

7 protocols using takara primescript 1st strand cdna synthesis kit

Quantifying miR-27b-3p and PPARG Expression

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

TRIzol reagent was employed to extract miR-27b-3p and PPARG from the H9C2 cell line. The TaKaRa PrimeScript 1st Strand cDNA Synthesis Kit (TaKaRa Bio Inc, Japan) was adopted to reverse-transcribe miR-27b-3p and PPARG into cDNA. SYBR Green qPCR Master Mix (MedChemExpress, NJ, USA) and the IQ5 Multicolor qRT-PCR Detection System (Bio-Rad, USA) were utilized for real-time fluorescent quantitative PCR. The relative expression was calculated based on the 2^−ΔΔCT value of each gene, and all experiments were repeated 3 times. GAPDH and U6 were taken as the internal parameters of PPARG and miR-27b-3p, respectively [23 (link)]. The primer sequences are detailed in Table 1.

Table 1.

The sequence of each molecular primer

Genes	Primer sequences (5’‐3’)
PPARG	Forward	TTTCCTGTCAAGATCGCCCT
PPARG	Reverse	TTGCAGTGGGGATGTCTCAT
miR-27b-3p	Forward	AGGGTTCACAGTGGCTAAG
miR-27b-3p	Reverse	GAGAGGAGAGGAAGAGGGAA
GAPDH	Forward	TGTGTCCGTCGTGGATCTGA
GAPDH	Reverse	TTGCTGTTGAAGTCGCAGGAG
U6	Forward	CTCGCTTCGGCAGCACA
U6	Reverse	AACGCTCTCACGAATTTGCGT

Zhao H., Wang Y, & Zhu X. (2022). Chrysophanol exerts a protective effect against sepsis-induced acute myocardial injury through modulating the microRNA-27b-3p/Peroxisomal proliferating-activated receptor gamma axis. Bioengineered, 13(5), 12673-12690.

+ Open protocol

+ Expand

Quantitative RNA Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted using TRIzol (Life Technologies, Carlsbad, CA, USA) according to the manufacturer’s instructions. RNA was quantified and used to generate cDNA using the Takara PrimeScript 1st strand cDNA Synthesis Kit (Takara Bio Inc, Seoul, Korea). qRT-PCR was performed using a Power-up SYBR Green Master Mix (Thermo Fisher Scientific, Waltham, MA, USA), while mRNA detection was performed using an ABI Step One Real-time PCR System (Applied Biosystems, Foster City, CA, USA). The comparative CT method was used to determine the relative expression in each sample using β actin as normalized control. Primers were obtained from Macrogen (Macrogen, Inc., Seoul, Korea).

Pandey K., Lee E., Park N., Hur J., Cho Y.B., Katuwal N.B., Kim S.K., Lee S.A., Kim I., An H.J., Hwang S, & Moon Y.W. (2021). Deregulated Immune Pathway Associated with Palbociclib Resistance in Preclinical Breast Cancer Models: Integrative Genomics and Transcriptomics. Genes, 12(2), 159.

+ Open protocol

+ Expand

Quantifying HIF-1α and Prion Protein Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from HCT116 cells using the Easy-spin™ Total RNA Extraction kit (iNtRON Biotechnology, Daejeon, Korea). cDNA was synthesized using the TaKaRa Prime Script™ 1st strand cDNA synthesis kit (Takara Bio Inc., Shiga, Japan) following the manufacturer's instructions. The following primers were designed:
HIF-1α: forward 5′-CGCAAGTCCTCA AAGCAC AG-3′; reverse 5′-TGGTAGTGGTGGCATTAGCA-3′;
Prnp: forward, 5′-GTGCACGACTGCGTCAAT-3′; reverse, 5′-CCTTCCTCATCCCACTATCA-3′;
β-actin: forward, 5′-GCAAGCAGGAGTATGACG AG-3′; reverse, 5′-CAAATAAAGCCATGCCAATC-3′.
All Thunderbire™ SYBR qPCR mix reactions (TOYOBO, Tokyo, Japan) were performed on the CFX96 real-time PCR detection system (Bio-Rad, Hercules, CA, USA).

Park J.Y., Jeong J.K., Lee J.H., Moon J.H., Kim S.W., Lee Y.J, & Park S.Y. (2015). Induction of cellular prion protein (PrPc) under hypoxia inhibits apoptosis caused by TRAIL treatment. Oncotarget, 6(7), 5342-5353.

+ Open protocol

+ Expand

Quantitative RT-PCR Analysis of PIK3CA

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from the cells using TRIzol (Life Technologies). Total RNA was reverse transcribed to cDNA using the Takara prime script 1st strand cDNA synthesis kit (catalog no. 6110A, Takara Bio Inc.), according to the manufacturer’s instructions. qRT-PCR was performed using an ABI StepOne Real-Time PCR System (Applied Biosystems, Warrington, UK) and a Power-up SYBR Green Master Mix (catalog no. A25741, Thermo-Fisher Scientific). The expression of the target gene was normalized to that of glyceraldehyde 3-phosphate dehydrogenase (GAPDH). Primer sequences for GAPDH were as follows: 5′-CAGCCTCAAGATCATCAGCA-3′ (forward) and 5′-TGTGGTCATGAGTCCTTCCA-3′ (reverse). PIK3CA primers were as follows: 5′-AACAATGCCTCCACGACCAT-3′ (forward) and 5′-TCACGGTTGCCTACTGGTTC-3′ (reverse).

Jeong Y.G., Katuwal N.B., Kang M.S., Ghosh M., Hong S.D., Park S.M., Kim S.G., Kim T.H, & Moon Y.W. (2023). Combined PI3K Inhibitor and Eribulin Enhances Anti-Tumor Activity in Preclinical Models of Paclitaxel-Resistant, PIK3CA-Mutated Endometrial Cancer. Cancers, 15(19), 4887.

+ Open protocol

+ Expand

Total RNA Extraction from T. wilfordii

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from 100 mg of T. wilfordii roots using the plant total RNA extraction kit (TIANGEN Biotech Co., Ltd., Beijing, China). The RNA quality and concentration were measured by gel electrophoresis (1% agarose) and spectrophotometer analysis. The total RNA was reverse transcribed into cDNA template using Takara PrimeScript™ 1st strand cDNA synthesis kit (TaKaRa Biotechnology, Dalian, China).

Zhang B., Liu Y., Chen M., Feng J., Ma Z., Zhang X, & Zhu C. (2018). Cloning, Expression Analysis and Functional Characterization of Squalene Synthase (SQS) from Tripterygium wilfordii. Molecules : A Journal of Synthetic Chemistry and Natural Product Chemistry, 23(2), 269.

+ Open protocol

+ Expand

Granulosa Cell Transcriptome Profiling

Check if the same lab product or an alternative is used in the 5 most similar protocols

CCs were collected on the day of oocyte retrieval. In particular, the cells were segregated from cumulus-oocyte complexes (COCs) through the process of stripping using the mechanical method. Granulosa cells surrounding oocytes were collected from 18 patients (59 COCs) and stored in −80°C before RNA extraction. Total RNA from these cells was extracted using NucleoSpin RNA XS [12 ] (MACHEREY-NAGEL GmbH and Co. KG, Dϋren, Germany) and Qiagen RNeasy Micro Kit [13 ] (Qiagen, Hilden, Germany). cDNA was converted from extracted total RNA using TaKaRa PrimeScript 1^st strand cDNA Synthesis Kit [14 ] (TaKaRa, Japan) and Qiagen Quantitect RT Kit [15 ] (Qiagen, Hilden, Germany) with Bio-Rad T100 thermocycler (Bio-Rad Laboratories, Hercules, CA)[16 ] following manufacturer protocols.

Chokjirawat T., Sukpresert M., Choktanasiri W., Waiyaput W., Saengwimol D., Taweewongsounton A., Pongrujikorn T, & Satirapod C. (2018). Luteinizing Hormone Receptor Gene and Regulator of G-protein Signaling 2 Gene Expression Level and Association with Oocyte Maturity in In vitro Fertilization/Intracytoplasmic Sperm Injection Cycle. Journal of Human Reproductive Sciences, 11(1), 52-58.

+ Open protocol

+ Expand

Quantitative Analysis of Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from SK cells using Easy-spin Total RNA Extraction Kit (iNtRON Biotechnology, Seoul, Korea). cDNA synthesis was carried out using TaKaRa Prime Script 1st Strand cDNA synthesis kit (TaKaRa Bio, Tokyo, Japan). For quantitative real-time PCR, 1 μl of gene-speci c primers and SYBR Green Supermix (Bio-Rad Laboratories, Hercules, CA) were used in 20 μl of reaction volume. The primers were as follows: TNF-α, forward = 5′TCT CCT TCC TGA TCG TGG C′ and reverse = 5′ GGT TCA GCC ACT GGA GCT 3′; COX-2, forward = 5′ AAA TTC GGT ACA TCC TCG AC 3′ and reverse = 5′ CAG GAA CTG GAT CAG GAC TT 3′; glyceraldehyde-3-phosphate dehydrogenase (as an internal control): forward = 5′ TGC CTC CTG CAC CAA CT3′ and reverse = 5′CGC CTG CTT CAC CTT C 3′. All quantitative PCR reactions were performed on a CFX96 real-time PCR detection system (Bio-Rad).

Hong J.M., Moon J., Seol J., & Park S. (2021). Melatonin-mediated Calcineurin Inactivation Attenuates Prion Protein-induced Nf-Kb- Driven Pro-Inflammation Response.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!