Q5 hot start dna polymerase

Genomic DNA was extracted from 10 ml of exponentially growing cells with the Gentra Puregene Yeast/Bact. Kit (QIAGEN) according to the manufacturer’s protocol. For the C-tailing reaction, 100 ng of genomic DNA were mixed with 0.9 μl of NEB buffer 4 in a final volume of 9 μl. To denature the DNA, the mixture was incubated at 96°C for 10 min and cooled to 4°C. 4 units of terminal transferase (NEB) were added together with dCTP in a final concentration of 0.1 mM. The C-tailing reaction was carried out as follows: 37°C for 30 min; 65°C for 10 min; 96°C for 5 min; hold at 65°C. 30 μl of pre-heated PCR mix were added to the DNA. The PCR mix contained 4 μl of 2 mM dNTPs, 4 μl of PCR buffer (670 mM Tris-HCl pH 8.8, 160 mM (NH₄)₂SO₄, 70% glycerol, 0.1% Tween-20), 0.4 μl of Q5 Hot Start DNA Polymerase (2 u/μl, NEB) and the primers oBL358 and oBL359. The following cycling conditions were used for PCR: 95°C for 3 min; 45 cycles of 95°C for 30 s, 63°C for 15 s and 72°C for 20 s; 72°C for 5 min; hold at 4°C. PCR products were separated on an 1.8% agarose gel containing 1X SYBR Safe DNA gel stain and imaged on the Bio-Rad ChemiDoc Touch Imaging System.

For genotyping, flies were frozen, and DNA was extracted by grinding flies from SNc9XSGr1 and SNc9XSGr2 lines separately in 200 µL DNAzol (Thermo Fisher) and an appropriate amount of 75% ethanol solution. The DNA was used as a template for PCR using Q5 Hot Start DNA Polymerase from New England Biolabs according to the manufacturer’s protocol. The region of interest containing the promoter and 5′ UTR fragment was amplified using DNA oligo primers AutoB_left_S_F and Cas9_S1_R (see ApE file for primer sequences). This would allow amplification of the DNA fragment with a 30 s PCR extension time. After DNA fragments were isolated by gel electrophoresis, sequences were obtained by Sanger sequencing and analyzed with ApE software⁵⁴ .

The Thermo Fisher Scientific (Waltham, MA, USA) multiplex primer analyzer was used to identify which primers were most suitable for multiplexing for amplicon generation. This resulted in multiplex 1 (ace1 and vgsc-3), multiplex 2 (rdl and vgsc-2), multiplex 3 (vgsc-4 and gste2) and a simplex reaction (vgsc-1). Each PCR reaction had a final reaction volume of 25 μl, containing 0.25 μl Q5 Hot-start DNA polymerase (New England Biolabs Ltd., Hitchin, UK), 5 μl of Q5 buffer (New England Biolabs Ltd.), 1 μl of DNA template (2–10 ng), 0.5 μl of 10 mM dNTPs, an average of 0.63 μl of each forward and reverse primer at 10 μM and 15.75 μl of nuclease-free H₂O. PCR amplifications were conducted using the following reaction conditions: hot-start activation of Q5 Hot-start DNA polymerase for 30 s at 98 °C; followed by 35 cycles of denaturation at 98 °C for 10 s, annealing at 57 °C for 60 s and elongation 72 °C for 60 s; with a final elongation step of 72 °C for 2 min.

Libraries for Illumina MiSeq sequencing were prepared by PCR with oligos containing required adaptors and unique indices to allow all pre- and post-selection libraries to be sequenced in a single experiment.
Pre-selection libraries were amplified directly from the streptavidin beads isolated from assembly. Post-selection libraries were amplified from purified plasmid DNA extracted from recovered transformants. Libraries were amplified in 50 µL reactions using NEB Q5 Hot-start DNA polymerase to minimize amplification errors and PCR cycles capped at 20 to minimize amplification biases. Reactions contained 1 U polymerase, 0.2 µM each of oligos xxx-MiSeqF (separate oligo for each library, with varying index sequences for demultiplexing, names and sequences are in Supplementary Table 4) and TEM1-MiSeq-R, 1 ng plasmid template or 1 µL resuspended bead slurry from the assembled library, 200 µM dNTPs, 1× Q5 reaction buffer, and 1× CES enhancer solution^{31 (link)}. Product size and purity were checked on agarose gels and correct amplicons excised and purified using Monarch Gel Extraction (NEB).
Libraries were quantified by fluorimetry using a Qubit 3.0 (Thermo Fisher Scientific) with a dsDNA HS assay kit and pooled proportionally to obtain the desired number of reads for each sample. Sequencing was carried out on an Illumina MiSeq instrument by UCL Genomics using a 150 cycle v3 kit.

Viral RNA was isolated with a QIAamp viral RNA kit (QIAGEN), and cDNA produced using the Superscript IV Reverse Transcriptase (Invitrogen). Amplicons were prepared for sequencing using the Illumina TruSeq system with two rounds of PCR using Q5 Hot Start DNA polymerase (NEB). For the first round of PCR, primers were specific to the DENV2 E sequence surrounding the FL motif with overhangs for the Illumina adapters (RT: CGCAGCTAGAATCGATCTAGCNNNNNNNNNNNNNNNTGTGCACCAGCCAAGC; F:CCCTACACGACGCTCTTCCGATCTNNNNNCAAACCAACATTGGATTTTGAACTG; R:GACTGGAGTTCAGACGTGTGCTCTTCCGATCTNNNNNCGCAGCTAGAATCGATCTAGC). After purification, this product was used as the template for the second round of PCR using Illumina P5 and P7 primers containing 8-nucleotide indexes (P5: CAAGCAGAAGACGGCATACGAGATNNNNNNNNGTGACTGGAGTTCAGAC; P7: AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG). Purified PCR products were analyzed on a Bioanalyzer (Agilent Technologies) and quantified on a Qubit 4 fluorometer (Invitrogen). Amplicon libraries were run on a MiSeq system with 2 × 150 bp reads. Plasmid and P0 libraries were sequenced at a depth of ~4.5 million reads; later passages were sequenced at a depth of ~750,000 reads. Custom Perl and R scripts were used to analyze and plot the data as previously published (Tse et al., 2022 (link)) and can be found the Tse Lab GitHub site (Meganck, 2022 ).