Mandra1

Cells were fixed in phosphate buffered saline (PBS) containing 4% paraformaldehyde for 15 min at room temperature, washed with PBS, and treated with PBS containing 0.1% Triton X-100 and 5% goat or donkey serum for 30 min at room temperature. Thereafter, cells were stained with the following primary antibodies for 1 h at room temperature or overnight at 4°C: anti-NANOG (1:100, R&D Systems), anti-TRA-1-81 (1:100, Millipore), anti-cardiac troponin T (cTnT; 1:200, Thermo Scientific), and anti-dystrophin (1:100, MANDRA1, Sigma-Aldrich). Next, cells were stained with the following secondary antibodies for 1 h at room temperature: Cy3-conjugated donkey anti-mouse IgM (1:500, Jackson ImmunoResearch), Alexa Fluor 488-conjugated donkey anti-goat IgG (1:500, Invitrogen), Alexa Fluor 568-conjugated donkey anti-mouse IgG (1:500, Invitrogen) and a Zenon Alexa Fluor 488 labelling kit (Invitrogen). Nuclei were counterstained with 10 μg/mL Hoechst 33342 (Invitrogen). Images were acquired using a fluorescence microscope (BZ-X700 or BZ-X710, Keyence). Confocal images were captured by TCS SP8 confocal microscope (Leica Microsystems).

Hematoxylin and eosin staining was used to examine the overall muscle morphology of 10 μm TA muscle sections. For immunohistochemistry, muscle cryo-sections were stained using Mouse on Mouse (M.O.M) kit (Vector Labs). Primary antibodies were incubated overnight at 4 °C followed by three washes with PBS-0.1% Tween and incubated with goat anti-mouse or goat anti-rabbit secondary antibodies (Life Technologies; 1:400) conjugated to Alexa 488, Alexa 555 or Alexa 647. Antibodies against dystrophin (Manex1011B, 1:100, mouse monoclonal, gift from Dr Glenn Morris; Dys1 and Dys2, 1:100, mouse monoclonal, Novocastra; MANDRA1, 1:1,000, Mouse monoclonal, Sigma-Aldrich), α-syntrophin (rabbit polyclonal, 1:200, Abcam), α-dystrobrevin (mouse monoclonal, 1:200, BD Biosciences); anti-MHCIIa (SC71, 1:3, mouse monoclonal IgG1; Hybridoma DSHB), anti-MHCIIX (6H1, 1:2, mouse monoclonal IgM; Hybridoma DHSB), laminin (1:300, rabbit polyclonal, Chemicon) were used.

Injections of zebrafish were performed in 1–4 cell stage blastulae. Antisense morpholino oligonucleotide (AMO; 5′- GTCCGCCTCCTTAGACAGAGGAAAA -3′) was design and manufactured by Gene Tools to bind and inhibit specifically dmd exon 78 inclusion. Dose-dependence curves of AMO were performed (0.1–0.7 mM) and AMOs were injected at a concentration of 0.1 and 0.3 mM to minimize morpholino-induced developmental delay and toxicity and to yield a consistent motor phenotype. After harvesting at 48 hpf developmental stages, zebrafish embryos were fixed with paraformaldehyde 4% for 2 h and dehydrated with MetOH 50% during 5 min followed by MetOH 100% for 5 min. After permeabilization with 70% EtOH, 20% acetic acid in PBS and blocking with 5% goat serum, 0.5% triton X-100 (Sigma-Aldrich), embryos were incubated overnight at 4 °C with mouse monoclonal anti-dystrophin (MANDRA1, Sigma 1:1,000) or mouse monoclonal F59 anti-slow-twitch myosin (1:10) in a 5% goat serum, 0.5% triton X-100 solution. Then the embryos were washed in PBS containing 0.1% Tween-20, incubated overnight at 4 °C with cy3-conjugated goat anti-mouse secondary antibody (Life Technologies; 1:400), washed with PBS containing 0.1% Tween-20 and mounted in glass slides.