Superose 6 column

Human TRF2 and TRF2-ΔiDDR were cloned into a modified pFastbac vector with a His₆-MBP tag and a 3C protease cleavage site. Proteins were expressed in insect cells grown for 72 h after infection with baculovirus, collected, frozen in liquid nitrogen and stored at −80 °C. Cell pellets were thawed and homogenized in lysis buffer (40 mM Tris pH 8, 500 mM NaCl, 0.5 mM TCEP, 10% glycerol, 0.1% Tween-20, 1 mM PMSF, protease inhibitor cocktail (Roche)). Cells were pelleted at 18,000g and incubated with 1 ml Ni-NTA resin for 1 h. The resin was washed with buffer A (40mM Tris pH 8, 100 mM NaCl, 0.5mM TCEP, 10% glycerol) and proteins were eluted in buffer A and 200 mM imidazole. Proteins were incubated with 3C protease overnight at 8 °C and injected on a Hi-Trap Heparin column (Cytiva). After being washed extensively with buffer A, proteins were eluted in buffer B (40 mM Tris pH 8, 1 M NaCl, 0.5 mM TCEP, 10% glycerol). The most concentrated fractions were injected into a Superose 6 column (Cytiva) equilibrated in buffer A. Fractions were analyzed on SDS–PAGE for purity, pooled, concentrated to 1 mg ml⁻¹, aliquoted and flash-frozen in liquid nitrogen.

Molecular weight measurement was performed at CCRC (UGA, Athens, GA, USA) and determined by size exclusion chromatography (SEC) with RI detection. The sample (1.0 mg) was dissolved in 1 mL 50 mM ammonium acetate solution by subjecting the resulting mixture to sequential heating and cooling steps as previously described [38 (link)]. Sample mixtures were slowly heated to about 80 °C and then allowed to slowly cool.
The method used for SEC was adapted from Yanagisawa et al. [39 (link)]. The SEC system used was Agilent 1260 Infinity, which consists of a quaternary pump (G7111B) with a built-in degasser, high-performance autosampler (G7129A), and a refractive index detector (G7162A). A Superose 6 column from Cytiva was used for the separation. The eluent was 50 mM ammonium acetate. SEC conditions were as follows: sample concentration of 1 mg/mL, injection volume of 100 µL and flow rate of 0.5 mL/min. The RI detector cells were kept at 35 °C.

mPSF complexes comprising CPSF160–WDR33^1–410–CPSF30–hFip1^1–198 for SEC-MALS analysis were produced as described above with subsequent tag removal by incubation with His₆-TEV protease. mPSF (assuming to comprise two hFip1) was supplemented with untagged PAP^1–504 in 2.5-fold molar excess and 1.2-fold molar excess of a 27-nt RNA substrate based on the SV40 pre-mRNA containing a PAS and a 3′ penta-A tail (CUGCAAUAAACAACUUAACAACAAAAA). The complex was purified on a Superose 6 column (Cytiva) in 20 mM HEPES pH 8.0, 150 mM KCl, 0.5 mM TCEP. The mPSF–PAP complex was concentrated in centrifugal filter (Amicon Ultra-15, MWCO 100 kDa, Merck Millipore), aliquoted, flash frozen, and stored at −80°C.

Pelleted cells were resuspended in lysis buffer (40 mM HEPES, pH 8.0, 250 mM KCl, 2 mM DTT, 2 mM benzamidine, 1 mM EDTA, 5% glycerol, 0.1% Tween-20®, and Roche cOmplete™ EDTA-free Protease Inhibitor Cocktail). Cells were lysed and centrifuged for 1 h at 48,380 × g in a Beckman Coulter Avanti JXN-26 centrifuge. Cleared lysate was filtered using filter syringes tips before being loaded onto a StrepII-Trap® HP Column (Cytiva). Augmin complexes were eluted with lysis buffer supplemented with 2.5 mM d-desthiobiotin. Augmin was concentrated and further purified over a Superose 6 column (Cytiva) in 20 mM HEPES, pH 8.0, 200 mM KCl, and 0.5 mM TCEP. Samples were further concentrated for cryo-EM and CLMS. Typically, 200 µl of augmin^ΔH6C at a concentration of 0.1–0.2 mg/ml was achieved from 3.0 l of insect cell culture. For the holo-complex, ~80 µl of sample at a similar concentration was obtained. Sample quality decreases dramatically after freezing and thawing; thus, freshly purified samples were always used for cryo-EM or CLMS.