Pgem t easy vector

Manufactured by Transgene

Sourced in China

The pGEM-T Easy vector is a linear plasmid vector designed for the cloning of PCR products. It contains a multiple cloning site within the lacZ gene, allowing for blue-white screening of recombinant clones. The vector also includes T7 and SP6 RNA polymerase promoters flanking the insert for in vitro transcription.

Automatically generated - may contain errors

Lab products found in correlation

Trizol reagent, by Takara Bio (2 mentions) Reverse transcriptase, by Takara Bio (2 mentions) Dh5α competent cells, by Takara Bio (2 mentions) Generacer, by Thermo Fisher Scientific (2 mentions) Dna gel extraction kit, by Corning (1 mentions) Dna extraction kit, by Takara Bio (1 mentions) One step clone kit, by Vazyme (1 mentions) Cdna synthesis kit, by Takara Bio (1 mentions) Peasy uni seamless cloning and assembly kit, by Transgene (1 mentions) Transetta de3 cells, by Transgene (1 mentions) Bamhi xhoi, by Takara Bio (1 mentions) Axyprep dna gel extraction kit, by Corning (1 mentions) Axyprep plasmid miniprep kit, by Corning (1 mentions) T4 ligase, by Takara Bio (1 mentions) Isopropyl β d 1 thiogalactopyranoside (iptg), by Sangon (1 mentions) Trans t1 cells, by Transgene (1 mentions) Bam hi sal 1, by Takara Bio (1 mentions)

Spelling variants of this product

T vector (11 citations)

11 protocols using pgem t easy vector

Molecular Detection of Tick-Borne Pathogens

Check if the same lab product or an alternative is used in the 5 most similar protocols

We used a partial 16S rRNA gene to detect Anaplasma spp., A. phagocytophilum, Ehrlichia spp., and E. chaffeensis, as described previously (26 (link)–29 (link)). The molecular detection of Rickettsia was performed using the citrate synthase (gltA) and outer membrane protein B (ompB) genes (30 (link)). A. ovis and E. canis were detected based on the major surface protein 4 (msp4) gene (26 (link)) and gltA gene (31 (link)), respectively. Brucella spp. were identified using the partial omp22 gene encoding 22-kD outer membrane protein (8 (link)). The DNA of Anaplasma, Ehrlichia, Rickettsia, and Brucella amplified in our laboratory was used as positive controls. Double-distilled water was used as a negative control (Dongsheng, Guangzhou, China). The amplified products were cloned into the pGEM-T Easy vector (TransGen Biotech, Beijing, China), according to the instructions, and then sequenced.
The sequence results were compared with the reference sequences available in centralized databases using a basic local alignment search tool (BLAST) (http://www.ncbi.nlm.nih.gov/BLAST/). Phylogenetic trees were constructed using the maximum-likelihood method using MEGA X software (https://www.megasoftware.net).

Guo J., Song S., Cao S., Sun Z., Zhou Q., Deng X., Zhao T., Chai Y., Zhu D., Chen C., Baryshnikov P.I., Blair H.T., Wang Z., Wang Y, & Zhang H. (2022). Molecular Detection of Zoonotic and Veterinary Pathogenic Bacteria in Pet Dogs and Their Parasitizing Ticks in Junggar Basin, North-Western China. Frontiers in Veterinary Science, 9, 895140.

+ Open protocol

+ Expand

Cloning Porcine Viperin Gene from PAMs

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from PAMs using TRIzol Reagent (TaKaRa, China) and transcribed into cDNA using reverse transcriptase (TaKaRa). Viperin was amplified using oligonucleotide primers (Table 1) designed based on a porcine viperin sequence (NM_213817.1) obtained from the GenBank database. The amplified fragment was cloned into pGEM-T Easy Vector (Transgen, Beijing).Table 1

Primers for cloning the viperin gene

Primer set	Accession no.	Primer sequence (5′- 3′)	Tm (°C)
Viperin-T	NM_213817.1	F: ACCTGCTGCCATGTGGACACTGGTA	56
Viperin-T	NM_213817.1	R: GCTCAGCTCTCAGCTTCACCAGTCC	56

Wu J., Chi H., Fu Y., Cao A., Shi J., Zhu M., Zhang L., Hua D, & Huang J. (2020). The antiviral protein viperin interacts with the viral N protein to inhibit proliferation of porcine epidemic diarrhea virus. Archives of Virology, 165(10), 2279-2289.

+ Open protocol

+ Expand

Cloning and Sequencing of PBP Genes

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

CpunPBP2 (GenBank accession number: GEDO010000019.1; Jia et al., 2016 (link)) and CpunPBP5 (GenBank accession number KP985227) of C. punctiferalis were obtained from the antennal cDNA library. The primers were designed to clone the coding region of CpunPBP2 and CpunPBP5 (Table S1; Underlined bases show restriction enzyme sites for forward and reverse primers, respectively). PCR products were separated by electrophoresis on 1% agarose gels in 1 × TAE buffer. Then the specific fragments were cut and purified by DNA gel extraction kit (Axygen, Hangzhou, China) following the manufacturer's protocol. The purified products were cloned into pGEM-T easy vector (TransGen, Beijing, China) and then transformed to TransT1 E. coli competent cells (TransGen, Beijing, China). Positive clones were selected by PCR using M13 primers and then sequenced.

Ge X., Ahmed T., Zhang T., Wang Z., He K, & Bai S. (2018). Binding Specificity of Two PBPs in the Yellow Peach Moth Conogethes punctiferalis (Guenée). Frontiers in Physiology, 9, 308.

+ Open protocol

+ Expand

High-throughput Pina and Pinb Allele Identification

Check if the same lab product or an alternative is used in the 5 most similar protocols

High throughput EcoTILLING analysis was applied to identify Pina and Pinb alleles in the selected germplasm. The method was followed with Li et al. (2013) with minor modifications based on gene cloning to minimize the use of control DNA templates. Firstly, three dominant allelic variants of Pina (Pina-D1a from Chinese Spring) and Pinb (Pinb-D1a from Chinese Spring and Pinb-D1b from Neimai 11) were cloned into the pGEM-T Easy vector (Transgen, Beijing, China) as the control samples, respectively. The nested PCR was used to detect Pina and Pinb allelic variants (Fig. 1; Additional file 1: Table S3). The full length of Pina and Pinb were amplified individually from genomic DNA of tested samples with primers (Pina-Out-F/R, Pinb-Out-F/R) in the first step PCR reaction. Then, the PCR products and the plasmids (containing Pina-D1a, Pinb-D1a and Pinb-D1b, respectively) were diluted for 100-fold as templates for the second step PCR reaction individually. To improve the amplification efficiencies, the fluorescently labeled primers (LI-COR Biosciences, Lincoln, USA) were mixed with unlabeled primers (Pina-In-F/R, Pinb-In-F/R) in 1:1 ratio for the second step PCR reaction.

Ma X., Sajjad M., Wang J., Yang W., Sun J., Li X., Zhang A, & Liu D. (2017). Diversity, distribution of Puroindoline genes and their effect on kernel hardness in a diverse panel of Chinese wheat germplasm. BMC Plant Biology, 17, 158.

+ Open protocol

+ Expand

Site-Directed Mutagenesis of CpunPBP Proteins

Check if the same lab product or an alternative is used in the 5 most similar protocols

Four mutants of CpunPBP2 and four mutants of CpunPBP5 were developed using the QuikChange Lightning Site-Directed Mutagenesis Kit (Stratagene, USA). The mutational primers were designed manually. Mutation sites are underlined in Table S2. The CpunPBP2/pGEM-T Easy construct was used as a template. The PCR conditions were 95°C for 5 min, followed by 30 cycles of 95°C for 30 s, 58°C for 30 s and 68°C for 1 min, and final extension at 72°C for 10 min. The correct insertion of mutation was subcloned into pGEM-T Easy vector (TransGen, Beijing, China). The expression system and fluorescence binding assay were conducted as mentioned for wild type proteins.

Ge X., Ahmed T., Zhang T., Wang Z., He K, & Bai S. (2018). Binding Specificity of Two PBPs in the Yellow Peach Moth Conogethes punctiferalis (Guenée). Frontiers in Physiology, 9, 308.

+ Open protocol

+ Expand

Cloning and Characterization of Porcine TFDP2

Check if the same lab product or an alternative is used in the 5 most similar protocols

The gene encoding TFDP2 (GenBank Accession No. XM_021069556.1) was amplified from 3D4/21 cells cDNA using the primers listed in Supplementary Table S1 and cloned into pGEM®-T Easy Vector (Transgen, Beijing, China). The CDS region of TFDP2 was amplified by PCR using specific primer pairs (Supplementary Table S1) and subcloned into the pFlag-CMV2 vector using a one-step clone kit (Vazyme, Nanjing, China).
Genomic DNA was extracted from PAMs using a DNA extraction kit (TaKaRa, Otsu, Shiga, Japan). The 1701-bp porcine TFDP2 promoter sequence (NC_010455.5) relative to the transcription initiation site (+1) was amplified by specific primers and ligated into luciferase reporter vector pGL3-Basic (named − 1301/400-Luc) using a one-step clone kit (Vazyme, Nanjing, China). The truncated mutants of TFDP2 promoter were then constructed by PCR using the − 1301/400-Luc plasmid as a template (− 792/400-Luc, − 67/400-Luc, − 17/400-Luc). Site-directed mutagenesis of the C/EBP-β, ATF-1, AP-1, SP1 binding sites was performed by PCR using the − 17/400-Luc vector as a template. The 1291-bp porcine cyclin A promoter (NC_010450.4) luciferase reporter plasmid was constructed as above described. The pRL-TK Renilla luciferase reporter plasmid was used as an internal control. All primers are listed in Supplementary Table S1.

Zhu M., Li X., Sun R., Shi P., Cao A., Zhang L., Guo Y, & Huang J. (2021). The C/EBPβ-Dependent Induction of TFDP2 Facilitates Porcine Reproductive and Respiratory Syndrome Virus Proliferation. Virologica Sinica, 36(6), 1341-1351.

+ Open protocol

+ Expand

Cloning and Characterization of CAD Genes

Check if the same lab product or an alternative is used in the 5 most similar protocols

S. litura larvae were purchased from Keyun Co. (Jiyuan, China). Total RNA was extracted from midgut tissue of 4th instar larvae using TriZol reagent according to the manual provided by the company (Life Technologies). The cDNA was synthesized using the cDNA synthesis kit from Takara (Dalian Bio., China) and the open reading frame of SlCAD was amplified by PCR using specific primers (Table S4) (GenBank: JN687590). The PCR reactions were done using I-5™ 2 × High-Fidelity Master Mix (Molecular Cloning Laboratories, MCLAB, San Francisco, CA, USA) according to the following program: 98 °C for 2 min (once), followed by 30 cycles, each cycle consisting in: 53 °C for 15 s, 72 °C for 40 s and 98 °C for 10 s.
The DNA fragments encoding H. virescens CAD (HevCAD) TB, TM and CPD (codifying for 1216-1732 amino acid residues) (GenBank: AF367362.1) were synthesized by Genscript Co. (Nanjin, China) and inserted into pGEM-T easy vector using pEASY-Uni seamless cloning and assembly kit from Transgen Biotech (Beijing, China). The sequences were confirmed by DNA sequencing.

Ma Y., Zhang J., Xiao Y., Yang Y., Liu C., Peng R., Yang Y., Bravo A., Soberón M, & Liu K. (2019). The Cadherin Cry1Ac Binding-Region is Necessary for the Cooperative Effect with ABCC2 Transporter Enhancing Insecticidal Activity of Bacillus thuringiensis Cry1Ac Toxin. Toxins, 11(9), 538.

+ Open protocol

+ Expand

Viral Genome Sequencing Workflow

Check if the same lab product or an alternative is used in the 5 most similar protocols

Each potential viral genome was further examined using one-step RT-PCR and rapid amplification of cDNA ends (RACE) kit (GeneRacer, Invitrogen, MD, USA) using overlapping primers designed from the assembled sequences (S3 Table). The resulting cDNA products were purified and cloned into the pGEM-T Easy Vector (TransGen Biotech, Beijing, China), which was later transferred into DH5α competent cells (Takara, CA, USA). At least five clones per amplicon were randomly selected and sequenced in both directions by the (BGI, Shenzhen, China).

Liu Q., Zhang S., Mei S., Zhou Y., Wang J., Han G.Z., Chen L., Zhou C, & Cao M. (2021). Viromics unveils extraordinary genetic diversity of the family Closteroviridae in wild citrus. PLoS Pathogens, 17(7), e1009751.

+ Open protocol

+ Expand

TRAIP Gene Expression Profiling

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNAs were extracted from PBMC cells using TRIzol reagent (TaKaRa, China). First-strand cDNA synthesis was carried out using reverse transcriptase (TaKaRa). TRAIP was synthesized using the specific primers based on the predicted TRAIP sequence (GenBank Accession Nos. XM_021068793.1) as shown in Table 1, and the amplified fragments were cloned into pGEM^®-T Easy Vector (Transgen, Beijing).

Shi P., Su Y., Li R., Zhang L., Chen C., Zhang L., Faaberg K, & Huang J. (2018). Dual Regulation of Host TRAIP Post-translation and Nuclear/Plasma Distribution by Porcine Reproductive and Respiratory Syndrome Virus Non-structural Protein 1α Promotes Viral Proliferation. Frontiers in Immunology, 9, 3023.

+ Open protocol

+ Expand

Viral Genome Confirmation via RT-PCR

Check if the same lab product or an alternative is used in the 5 most similar protocols

Each potential viral genome was further examined by one-step reverse transcription-PCR (RT-PCR) using overlapping primers designed on the assembled sequences (Additional le 2: Table S2) to con rm the results. The terminal regions of the potential viral genomes were determined using rapid ampli cation of cDNA ends (RACE) kit (GeneRacer, Invitrogen, USA). The resultant cDNA products were puri ed with a Biospin PCR Puri cation Kit (BioFlux) and cloned into the pGEM-T Easy Vector (TransGen Biotech), which was later transferred into DH5α competent cells (Takara). At least ve clones per amplicon were randomly selected and sequenced in both directions by the BGI Company (Beijing, China).

Liu Q., Zhang S., Mei S., Zhou Y., Zhou C., & Cao M. (2021). Viromics Unveils Extraordinary Genetic Diversity of the Family Closteroviridae in Wild Citrus.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!