Ffpe dna kit

Genomic DNA was extracted using the Qiagen FFPE DNA Kit (Qiagen, Valencia, CA, USA). Genomic DNA (1 μg per sample) was modified with bisulfite using the EZ DNA Methylation-Gold Kit (Zymo, Orange County, CA, USA) according to the manufacturer’s instructions. MSP was performed on the bisulfate-treated DNA. The primers used were unmethylated TP53, 5’-GGTTTTAGGATTAGAGGATAGATTGA-3’ (forward) and 5′-CCTTCCTACAAAA AAAACAAACAAA-3′ (reverse); and methylated TP53, 5′-GGGTTTTAGGATTAGAG GATAGATC-3′ (forward) and 5′-CTTCCTACAAAAAAAACAAACGAA-3′ (reverse). The annealing temperature was 58°C for both methylated and unmethylated PCR, with 35 cycles used for each.

For FFPE tissue blocks, the tumour containing areas in the primary and metastatic tumours were marked and cored (3–4 cores at 0.6 mm diameter). DNA was extracted from the tissue cores using the Qiagen FFPE DNA kit (Valencia, CA, USA) as per manufacturer's protocol. In 14 of the 30 cases, the carcinoma and sarcoma elements formed spatially distinct areas in the primary tumour, such that DNA from the separate components was extracted for comparison. The carcinoma and the sarcoma elements in the remaining 16 cases were closely admixed in the primary tumour and the extracted DNA represented a mixture of the two components. In 10 cases, DNA from the metastatic tumour was also extracted.
For FFT samples, all tumours were verified by frozen section to ensure adequate viability and cellularity of tumour tissue. The FFT tissue was then cryosectioned for DNA extraction using the Gentra Puregene kit (Qiagen) (Valencia, CA, USA) as per manufacturer's protocol. Germline DNA was extracted from buffy coat. In the cases where matched buffy coat was not available, DNA was extracted from normal FFPE tissue. All DNA was quantified using the Qubit fluorometer using Molecular Probes broad range Qubit quantification kit (Life Technologies) (Carlsbad, CA, USA).

DNA was extracted from the 108 effusion samples or CB samples using tissue DNA kit and FFPE DNA kit (QIAGEN, Hilden, Germany) respectively. EGFR was examined using amplification refractory mutation system (ARMS) PCR method. The ARMS PCR procedure was as follows: 5 μl of 1 (effusion samples) or 2 ng/μl (CB samples) template DNA solutions was added to each reaction buffer and then [1] (link) initial denaturation at 95°C for 5 min, [2] (link) 15 cycles of 95°C 25 s, 64°C 20s, and 72°C 20s, [3] (link) 31 cycles of 93°C 25 s, 60°C 35 s, and 72°C 20s was conducted before analyzing the results.

The FFPE DNA kit (Qiagen) was used to extract DNA from three to four sections of 5 µm thick FFPE tissues. The EGFR mutation was detected by the ARMS commercial regent (Amoy, Xiamen, China) according to the manufacturer’s protocol. Amplification conditions were conducted on the Applied Biosystems ABI 7500 PCR instrument (Thermo Fisher Scientific, Waltham, MA, USA) as follows: an initial denaturation at 95 ℃ for 5 minutes; 15 cycles, including denaturation at 95 ℃ for 25 seconds, annealing at 64 ℃ for 20 seconds, extension at 72 ℃ for 20 seconds; 31 cycles, including denaturation at 93 ℃ for 25 seconds, annealing at 60 ℃ for 35 seconds, extension at 72 ℃ for 20 seconds. FAM and HEX (or VIC) signals were collected at 60 ℃.

Genomic DNA was isolated from formalin‐fixed paraffin‐embedded (FFPE) tissues. The FFPE DNA kit (Qiagen, Valencia, CA, USA) was used to isolate genomic DNA from five scrolls of 7‐micrometer‐thick paraffin sections for each sample. PCR amplification focused on hotspot regions surrounding codon 600 in BRAF (forward 5′TGCTTGCTCTGATAGGAAAATG3′ and reverse5′CCACAAAATGGATCCAGACA3′), codon 12 of N‐RAS (forward 5′GACTGAGTACAAACTGGTGG3′ and reverse 5′GGGCCTCACCTCTATGGTG3′), and codon 61 of N‐RAS (forward 5′TCTTACCGAAAACAGGTGGTTATAG3′ and reverse 5′GTCCTCATGTATTGGTCTCTCATGGCAC3′) (Karbowniczek et al., 2008; Murua Escobar et al., 2004). PCR was performed using 100 ng of genomic DNA, primers, and PCR master mix (Qiagen) with 35 cycles with denaturing at 95°C for 45 s, annealing at 56°C for 45 s, and extension at 72°C for 60 s. Sequence analyses were performed on PCR products using sense and antisense primers.