Farb buffer

PBMC, OVSAHO and MCAS cells were lysed in 350 μL/well of FARB buffer (Favorgen) containing 3.5 μL/well of 98% 2‐mercaptoethanol (Sigma‐Aldrich), and the Blood/Cultured Cell Total RNA Mini Kit (Favorgen) was used to extract total RNA from the cells. cDNA was synthesized using 5 × RT Master Mix (Toyobo) according to the manufacturer's instructions, and qRT‐PCR was performed in duplicate using SYBR Green I Master Mix and a LightCycler 480 (Roche) according to the manufacturer's protocols. Forward and reverse primer sequences were: PD‐L1, 5′‐GGCATTTGCTGAACGCAT‐3′ and 5′‐CAATTAGTGCAGCCAGGT‐3′; IL‐6, 5′‐ACAAGCCAGAGCTGTGCAGATG‐3′ and 5′‐GTGCCCATGCTACATTTGCCGA‐3′; TGF‐β, 5′‐GCTGCCTGTGTGACTTTGG‐3′ and 5′‐TCCTGGATTCTAGCACTTCTGG‐3′; ROR‐γt, 5′‐GTGGGGACAAGTCGTCTGG‐3′ and 5′‐AGTGCTGGCATCGGTTTCG‐3′; IFN‐γ, 5′‐CGAGGGTTGAATGAGAGCTT‐3′ and 5′‐CAGACGGCTGCCTTTATAGC‐3′; GAPDH, 5′‐GAAAGGTGAAGGTCGGAGTC‐3′ and 5′‐GAAGATGGTGATGGGATTTC‐3′; IL‐17, 5′‐AGAGATATCCCTCTGTGATC‐3′ and 5′‐CACCCCAAAATTGTCTCAGG‐3′; IL‐27, 5′‐GAGCAGCTCCCTGATGTTTC‐3′ and 5′‐AGCTGCATCCTCTCCATGTT‐3′; tumor necrosis factor α (TNF‐α), 5′‐GGCGTGGAGCTGAGAGATAAC‐3′ and 5′‐GGTGTGGGTGAGGAGCACAT‐3′; and IL‐23A, 5′‐CAGTTCTGCTTGCAAAGGAT‐3′ and 5′‐ATCTGCTGAGTCTCCCAGTG‐3′. All the Ab were from Sigma‐Aldrich. The ratio of each gene product to GAPDH was used to determine mRNA expression according to the cycle‐threshold method.