Mir 30a 5p inhibitor

Cells at the density of 5 × 10⁴/well were inoculated into 24‐well plates, with the culture medium free from antibiotics. When cells grew to 70% confluence, pcDNA‐XIST (Genechem, Shanghai, China), si‐XIST‐1 (sense: 5′‐GCAAAUGAAAGCUACCAAU‐3′, antisense: 5′‐AUUGGUAGCUUUCAUUUGC‐3′, Genechem, Shanghai, China), si‐XIST‐2 (sense: 5′‐GCACAAUAUCUUUGAACUA‐3′, antisense: 5′‐UAGUUCAAAGAUAUUGUGC‐3′, Genechem, Shanghai, China), si‐XIST‐3 (sense: 5′‐CUAGAAUCCUAAAGGCAAA3′, antisense: 5′UUUGCCUUUAGGAUUCUAG3′, Genechem, Shanghai, China), miR‐30a‐5p mimic (sense: 5′‐UGUAAACAUCCUCGACUGGAAG‐3′, antisense: 5′‐CUUCCAGUCGAGGAUGUUUACA‐3′, Ribobio, Guangzhou, China), miR‐30a‐5p inhibitor (sense: 5′‐CUUCCAGUCGAGGAUGUUUACA‐3′, anti‐sense: 5′‐UGUAAACAUCCUCGACUGGAAG‐3′, Ribobio, Guangzhou, China), pCMV6‐ROR1 (OriGene Technologies, Rockville, MD, USA), and si‐ROR1 (sense: 5′‐AUCCGGAUUGGAAUUCCCAUG‐3′, antisense: 5′‐CAUGGGAAUUCCAAUCCGGAU‐3′; sense: 5′‐CUUUACUAGGAGACGCCAAUA‐3′, anti‐sense: 5′‐UAUUGGCGUCUCCUAGUAAAG‐3′, Open Biosystem, Huntsville, AL, USA) were transfected into Lovo cells, according to the instructions of Lipofectamine3000 (Invitrogen, Carlsbad, CA, USA).

The gene-overexpression vectors (pcDNA-NORAD and pcDNA-RAB11A) and the control vector (pcDNA) were purchased from GenScript Biotech Corp. (Nanjing, China). The small interfering RNAs against NORAD (NORAD siRNA), RAB11A (RAB11A siRNA) and negative control siRNAs (NC siRNAs) were designed, synthesized and validated by Thermo Fisher Scientific (Waltham, MA, USA). MiR-30a-5p mimic, miR-30a-5p inhibitor and the corresponding negative control (NC mimic and NC inhibitor) were purchased from RiboBio (Guangzhou, China). All these plasmids and oligonucleotides were transfected into PC-3 or LNCap cells by using lipofectamine 2000 transfection reagent (Invitrogen, Carlsbad, USA) under the suggestion of the manufacturer. At 48 h after transfection, cells were harvested for further study.