The largest database of trusted experimental protocols

Agarose

Manufactured by GoldBio

Agarose is a polysaccharide extracted from certain red algae. It is a commonly used biopolymer in various laboratory applications, primarily for gel electrophoresis techniques. Agarose forms a porous gel matrix that allows for the separation and analysis of macromolecules, such as DNA, RNA, and proteins.

Automatically generated - may contain errors

3 protocols using agarose

1

Biochemical Reagents for DNA Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
All metal chlorides, formamide, and CAPS buffer were purchased from Sigma-Aldrich. Tris base was purchased from J. T. Baker and glacial acetic acid was from Mallinckrodt Chemicals. Ethylenediaminetetraacetic acid (EDTA)-disodium salt was obtained from EMD Chemicals, Inc. The 2-Log DNA ladder, also called 1 kb Plus DNA ladder, 1 kb Extend DNA ladder, bacteriophage lambda DNA and M13mp18 DNAs were purchased from New England Biolabs. E. coli chromosomal DNA (D2001) was obtained from Sigma-Aldrich. Agarose was from Gold Biotechnology.
+ Open protocol
+ Expand
2

Montmorillonite Clay Oligonucleotide Preparation

Check if the same lab product or an alternative is used in the 5 most similar protocols
Powdered sodium montmorillonite (Na-MMT) was obtained from Southern Clay Products, Inc. This form of MMT is Na+ Cloisite, which is a water-washed homoionic sodium form of the clay having a cation exchange capacity of 95 meq/100 g. Purified E. coli transfer RNA(tRNA), tricine, triethanolamine, magnesium chloride, sodium chloride, sodium carbonate, and sodium sulfate were purchased from Sigma-Aldrich. Agarose was obtained from Gold Biotechnology. Boric acid and Tris base were from JT Baker. SYBR Gold was manufactured by Invitrogen Life Sciences. Ethidium bromide was from IBI Scientific. Eppendorf Flex-Tubes (1.5 mL) were purchased from VWR. Electrophoresis was performed using 11 cm × 14 cm Horizon gel rigs (Labrepco) and an EPS 601 power supply (GE Healthcare).
Oligonucleotides were purchased from Integrated DNA Technologies or from Invitrogen/ThermoFisher Scientific. Sequences of the oligomers were as follows:
PvuRNA (AAAUGAGUCACCCAGAUCUAAAUAA), cPvuRNA (UUAUUUAGAUCUGGGUGACUCAUUU), Pvu4a (AAATGAGTCACCCAGATCTAAATAA), cPvu4a (TTATTTAGATCTGGGTGACTCATTT), dsRNA 54mer RNALoop (AAAUGAGUCACCCAGAUCUAAAUAAGUAAUUAUUUUAGAUCUGGGUGACUCAUU), and ssRNA 54mer RNAStr8 (AAAUGAGUCACCCAGAUCUAAAUAAGUAAAAAUGAGUCACCCAGAUCUAAAUAA).
+ Open protocol
+ Expand
3

Halloysite-DNA Nanocomposites for Biomolecule Delivery

Check if the same lab product or an alternative is used in the 5 most similar protocols
Powdered halloysite, high molecular weight linear E. coli DNA (D2001) and metal chlorides were purchased from Millipore-Sigma. Kaolinite (KGa-1b) was obtained from The Clay Minerals Society (Purdue University). Halloysite nanotubes had lengths of 1–3 μm and diameters of 30–70 nm and previously reported cation exchange capacity of 8.0 meq/g. Kaolinite preparations contained 95–100% kaolin with 1–2% crystalline silica-quartz and cation exchange capacity of 0.02 meq/g (data from Clay Minerals Society). RNA and DNA oligonucleotides were purchased from Integrated DNA Technologies and ThermoFisher Scientific. The plasmid pRS316 has been described [44 (link)]. Agarose was obtained from Gold Biotechnology. Electrophoresis was performed using 11 × 14 cm Horizon gel rigs (Labrepco) as described [45 (link)]. Vacuum treatment of HNT solutions was performed for 5 min within an SC110 Speed Vac chamber containing an attached Savant GP110 pump.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!