The largest database of trusted experimental protocols

Sybr 2

Manufactured by Takara Bio
Sourced in China

SYBR II is a fluorescent dye used in real-time PCR applications. It binds to double-stranded DNA and emits a fluorescent signal upon excitation, which can be detected and quantified to measure the amount of DNA present in a sample.

Automatically generated - may contain errors

3 protocols using sybr 2

1

Hippocampal miRNA and mRNA Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
Hippocampus was dissected and stored at −80 Celsius. RNA was extracted by TRIzol (Invitrogen, USA), and cDNA was generated by PrimeScript® (Takara, China). qRT-PCR was carried out to measure miRNAs and mRNA expressions by SYBR II (Takara, China). The relative expressions were calculated by 2−ΔΔCT, using U6 snRNA and GAPDH as references. The primers are displayed in Table 1.

Sequences of Primers Used in qRT-PCR

GeneForward Primer (5ʹ-3ʹ)Reversed Primer (5ʹ-3ʹ)
miR-382-5pATCCGTGAAGTTGTTCGTGGTATGGTTGTAGAGGACTCCTTGAC
U6CTCGCTTCGGCAGCACAAACGCTTCACGAATTTGCGT
NR3C1CGAGCATGAGACCAGATGTACGACTGCTCTTTTGAAGAAA
GAPDHTGCACCACCAACTGCTTAGCGGCATGGACTGTGGTCATGAG
+ Open protocol
+ Expand
2

Quantitative Real-Time PCR Gene Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was isolated using the RNA Fast 200 purification kit from Fastagen Biotech (Shanghai, China) according to the manufacturer’s instructions. Reverse transcription of RNA was performed with ExScriptTM RT reagent kit (Takara Biotechnology Co., Ltd., Dalian, China). The cDNA was then subjected to RT-PCR. All primer pairs shown in Table II were designed by Oligo 6.0 primer analysis software (Oswel Research Products, Beijing, China). qPCR was performed in duplicate reactions of 12.5 μl volume SYBR II (Takara Biotechnology Co., Ltd.), 1 μl each of specific forward and reverse primers and 9.5 μl RNase Free H2O up to 24 μl. Samples were heated for 85°C followed by 40 cycles of amplification for 15 sec at 95°C and 1 min at 60°C. The mRNA level of β-actin was measured as an internal reference.
+ Open protocol
+ Expand
3

qRT-PCR Analysis of Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was extracted from all tested tissues with the EZ-10 DNAaway RNA Mini-prep Kit [Sangon Biotech (Shanghai), Co., Ltd], and then cDNA was synthesized from 1 µg RNA using the PrimeScript™ RT reagent kit with gDNA Eraser according to the manufacturer’s instructions (Perfect Real Time; TaKaRa Biotechnology, Dalian, China). The gene-specific primers for qRT-PCR of the candidate genes and reference gene are listed in Additional file 1: Table S7. The PCR consisted of 10 μL SYBR II (TakaRa), 2.0 μL cDNA, 1.6 μL primer, 0.4 μL ROX Reference Dye II and distilled water to a final volume of 20 μL. The PCR program was as follows: 95 °C for 30 s and 35 cycles of 95 °C for 5 s, followed by 56–60 °C (depending on the primers used) for 30 s. For each reaction, three biological replicates were performed, and relative expression levels were obtained using the 2−∆∆Ct method, with BnActin7 as internal controls.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!