Assay c 3084793 20

APOE genotyping was performed as previously published [44 (link)]. Briefly, genomic DNA was amplified in a 9700 Gene Amp PCR System (Applied Biosystems) using primers that amplify APOE gene’s exon 4. This PCR amplicon includes both the codon 112 (ε2/ε3 vs. ε4) and codon 158 (ε2 vs. ε3/ε4) polymorphic sites.
Taqman assay: SNPs rs429358 (ε2/ε3 vs. ε4) and rs7412 (ε2 vs. ε3/ε4) were genotyped using assay C_3084793_20 and assay C_904973_10 (Thermo Fisher), respectively. All reactions were carried out in a 9700 Gene Amp PCR System with a profile of 50 °C for 5 min; 95 °C for 5 min; 50 cycles of 95 °C for 15 s, and 60 °C for 1 min.
Sanger sequencing: The PCR reaction/amplicon (1 µl) was used in BigDye sequencing reaction (Thermo Fisher) with a final volume of 10 µl. All reactions were carried out in a 9700 Gene Amp PCR System with a profile of 94 °C for 1 min; 35 cycles of 94 °C for 30 s, 55 °C for 10 s, and 60 °C for 4 min; and a final extension of 60 °C for 5 min. The PCR generated sequencing products were further purified using EDTA/ethanol precipitation and then subjected to DNA sequencing run using SeqStudio (Thermo Fisher). The sequencing data (electropherograms) were transferred and uploaded onto the Sequencher program (Genecodes) for sequence alignment.
Primer sequences:
APOE_Ex4_F: 5′ TCGGAACTGGAGGAACAACT 3′.
APOE_Ex4_R: 5′ GCTCGAACCAGCTCTTGAGG 3′.