The largest database of trusted experimental protocols

Ready to go t primed first strand kit

Manufactured by Thermo Fisher Scientific
Sourced in Germany

The Ready-To-Go T-primed first strand kit is a pre-mixed, ready-to-use solution for the synthesis of first-strand cDNA from RNA templates. It provides a convenient and efficient method for the reverse transcription of RNA into cDNA for use in various downstream applications such as PCR and gene expression analysis.

Automatically generated - may contain errors

2 protocols using ready to go t primed first strand kit

1

Quantitative Real-Time PCR Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols
RNA was extracted using RNeasy mini kit (Qiagen, Hilden, Germany) according to the manufacture's instruction. cDNA was synthesized using Ready-To-Go T-primed first strand kit (Invitrogen) or OmniScript Reverse Transcriptase Kit (Qiagen) or Biozym cDNA synthesis kit including random hexamers (Biozym Scientific GmbH, Oldendorf, Germany). Quantitative real-time PCR was performed with StepOne™ Real-Time PCR System (Applied Biosystem, Darmstadt, Germany). In each reaction, 2 μl cDNA, 0.4 μl reverse and forward primers, 5 μl SYBR Green mix (Bioline, Taunton, USA) and 2.2 μl DEPC-H2O were mixed in one well in a 96-well plate and centrifuged briefly. After the initial denaturation step at 95 °C for 15 min, PCR reaction was cycled for 40 times with denaturation at 95 °C for 30 s and annealing-extension temperature at 65 for 30 s. Relative expression was calculated following 2-ΔΔCT method (Livak and Schmittgen, 2001 (link)). Primers are listed in Table S1. Statistical analysis was done using REST software and if p < 0.05, it is reported as statistically different (Pfaffl et al., 2002 (link)). The graphs were generated using GraphPad Prism Software version 7 (GraphPad Software Inc., California/USA).
+ Open protocol
+ Expand
2

Quantitative Real-Time PCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
RNA was extracted using RNeasy mini kit (Qiagen, Germany) according to the manufacture's instruction. cDNA was synthesized using Ready-To-Go T-primed first strand kit (Invitrogen, Germany). qRT-PCR was performed with StepOneTM Real-Time PCR System (Applied Biosystems, Germany). The primers were standardized and the efficiency was tested before performing real-time PCR; primers with an efficiency above 90% were used in this study. In each reaction, 1 μl cDNA, 1 μl reverse and forward primers (1:1), 4 μl EvaGreen mix and 14 μl DEPC-H2O were mixed in one well in a 96-well plate and centrifuged briefly. After the initial denaturation step at 95°C for 15 min, PCR reaction was cycled for 40 times with denature at 95°C for 30 s and annealing-extension temperature at 65°C for 30 s. Relative expression was calculated following the 2(-Delta Delta C(T)) method (55 (link)). Primers are listed in Table 5.

Primers for real-time RT-PCR

GenePrimerSequence (5′–> 3′)
Pax6Pax6-qFGTTCTTCGCAACCTGGCTA
Pax6-qRTGAGCTTCATCCGAGTCTTCT
TNF-αTNFα_2FCACCACGCTCTTCTGTCT
TNFα_2RGGCTACAGGCTTGTCACTC
IL-1βIL-1β_FWCAACCAACAAGTATTCTCCATG
IL-1β_RVGATCCACACTCTCCAGCTGCA
TubeaTubeaFCCAGATGCCAAGTGACAAGA
TubeaRGTGGGTTCCAGGTCTACGAA
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!