Pyromark q24 sequencer

We analyzed DNA methylation indexes of seven CpG sites in the differentially methylated region at 6q24.2 for the patient with mdnCNVs. These CpG sites are located within a differentially methylated region adjacent to PLAGL1, an imprinted gene involved in glucose homeostasis [9 (link), 10 (link)]. Usually, these CpG sites are methylated when transmitted from the mother and remain unmethylated when transmitted from the father [11 (link)]. Hypomethylation of these CpG sites is known to result in transient neonatal diabetes mellitus (TNDM) via PLAGL1 overexpression. Pyrosequencing was performed as described previously [12 (link)]. In brief, a genomic DNA sample obtained from the patient’s leukocytes was treated with bisulfite using the EZ DNA Methylation-Gold Kit (Zymo Research, Irvine, CA, USA). The genomic region encompassing seven CpG sites was PCR-amplified using 5′-biotinylated and unlabeled primers. The PCR products were hybridized to a sequencing primer and loaded on the PyroMark Q24 sequencer (QIAGEN, Hilden, Germany). Methylation indexes were calculated using the PyroMark CpG Software (QIAGEN). The results of the patient were compared with the reference data obtained from 49 unaffected Japanese individuals [11 (link)].

Pyrosequencing was performed using a PyroMark Q24 sequencer (Qiagen) with a PyroMark Gold Q96 Reagent Kit (Qiagen) according to the manufacturer's protocol. A mean methylation index was calculated from the CpG site methylation percentages for each gene. The results were analyzed using default software settings. We considered 0–5% unmethylated (hypomethylated), and values above 5% were considered methylated (hypermethylated)^{22 (link)}. The pyrosequencing primers are available upon request.

Primers sequences were designed using the Pyromark Assay by Design software as follows: Forward 5’ATTGCTTACATTTGCTTCTGACAC3’, Reverse 5’ACCAACTTCATCCACGTTCAC3’, targeting the same regions proposed by Sutton, Bouhassira [12 (link)]. PCR was performed with the PyroMark PCR Kit (QIAGEN) using 100 ng / μL of DNA according to the manufacturer's protocol. The PCR product was used for the pyrosequencing assay with PyroMark Q24 Gold Kit (Qiagen, Germany) and subsequently subjected to PyroMark Q24 sequencer (Qiagen, Germany) using the primer sequence 5’CATGGTGCATCTGACT3’. The analysis was performed using Pyrogram (PQ24 Software) version 2.1 (Qiagen, Germany) as shown in Fig 1.